Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig800  (registered. 2012)
Contig Information
Length 879 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 5
Wh_r Root 1
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|208293677|gb|ACI25443.1|| hypersensitive induced response protein 3 [Triticum aestivum]
Score 394
Evalue 6.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig800
TTTTTATAAGGCAAAAGCATTAGATCAAGTTCATCACCAACATTTCATAACACACTTATATCATCCTGCATTCACACAAGGTTAAAGGTTTTGTTACTGC
ACATCAACCTAAGGCATGGCATGCCACGATCCACATATGGTTCCATATAGGTTCATAAATAATACGGCATGCATCATATTAGACAGTACTGTAGGCAATA
GCTAGCAAACCACAAACCACCAGCAGCTTCAAAGTTCATGCCGGCGAAGCAAACTGCTAGTTGTCAGAGGCAGACTGGCCTTGAAGAAGACCGTCACGGA
TCTGCGTGGCGATGTCGCGCACCGCACCAGGGCCATGGGGGATGAACACCGCCGAGGACTTGGAGGACGCGCCAATCTCTTTCATAGTATCGAAGTACTG
GGTGATCAGCACCATGTCCATCACATCCTTTGCAGTGGTGCCAGGCACATTGACTGAGAAGCCCAGGACGCTGTCCCTCAGGCCATCCACAATGGCCTGG
CGCTGGCGGGCGATACCGAGGCCAGACAGGTACTTGGCCTCTGCTTCACCCTCGGCACGCTTGATCTGGACAATCTTCTCAGCCTCCGCCTTCTCGTTTG
CAGCCACCCTCATCCTTGCAGCTGCATTGATCTCATTCATCGCCTGCTTGACATGCGCATCTGGCTCGATGTCGACAATGAGGGTCTGCACGATCTCAAA
GCCATATGCCGACATAGCCTTTTCAAGTTCATCCTCCACAGCCTTTGCTATATCGTTCTTCTGCACGAAAGCATCATCCAGGTTGAGCTTTGGAACACTT
GCCCTGATCACATCAAAGACATAGGCTTGAATCTGGGATCTTGTGTTGGTCAGTTTGTAGTATGCGTCACTTTCTTTGC
page-top