Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7988  (registered. 2012)
Contig Information
Length 2526 bp
Clones alternative view 61 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125555209|gb|EAZ00815.1|| hypothetical protein OsI_22845 [Oryza sativa Indica Group]
Score 946
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7988
CCATCCAGACCAAGACCAAAAACTTCCCCTCCCCAACTCTCTCCGCCCCTGCGTGAACTGCGGAGCAAGGAAGGAGGAGCCGTCGGGCTACTAATCTTGG
GGGTTCCCCCTCTGATCCGGACGGTCTCGGCCGTTGCTGCTTGGGGAGGAGCGCCGCGGGTTCGTGGCGCCGGCGTCGGTTGGCGGGCGGTGGCCGGGGG
TCGTCGGTCCTTCGCTGGTTCTCTCGTCATCGGAAAAATAAATCGGTCGATCTGCCTCTGGTGAGGGATTTCTCAGATTGCGTCGCGCGGTTGGGTTCTC
CGGTGGGGCAAAGGCAGGATTTTGAGCCACTTTGCCCCTAAAATTAAATCTGATTTAATGGGCGACGAATCCAAAATGTGCCTGTAGCATCATCGGTTGT
GCCGTTTCTGGTGTCGGGCTTTCGCAGAGGGTTTCCTCCATCCATCATAGAAGGAAGGAACGGAACCCTTGGCTTGACTTCTCCATGGCTTCTACTAATT
CCTAGTGTAGAGCTTCTAACTCCGGTCCATTGTAAATATTGGCTGTAGTTGAGGAAGCTTTCGGCCTCCTGTAACCCCCCTTCGCGAAGATGTCGTCAGC
TGGTGTCATTGCGCTTGCTCCGATGACCGACGACCTCGCCTTCTTGCCCATCAGGTTTGATGGCAGTCGTTCAGCACACTGTTTCTCCGGGTCACAGCTG
CAGGATTCCATTCTCATCTTCCTTGCTGTGCCTGGTGCGCCTCCAATGCCGATGAGTGTGCTGGGCACTGATTCCATCGCTTCGGTGAAGCTGCGCATCC
AGAGGTTCAAGGGCTTTGTGGTGACAAAGCAGCGGCTCGTGCTCGACGGGCACGAGCTGGCGCGCAACAACTGCCCTGTCAAGGATTATGGGCTTGCCGA
TGGGAATGTTCTGCACCTTGTTATCCGCTTGGCTGACCTCCGGGTGATTAACATCGAAACCGCCAGTGGGAAGAAATTTCAGTTTCAGGTGGACCAGAGC
CGCAATGTCAAGTACCTCAAGAGTAAGCTTGCAGTGGAGGGTGATGAGGACCTTGATAGCCTGGAGGATGATGACAAGCTCGAGTACGATGGAGAGGTGC
TTGAGGACCACCAGTTGATTGCTGATATTAGCAACAAGGATGATGCTGTGATTCATTTGTTCATCCGCAAACCAGCAAAGGTACGAACACAGCAAGTTGA
TAAGGATACTGTGGTCACAGTTGACAACCCTCAGAAGAAAGAGAACCTACAGAATGAATCTGTTGTGGTGACCCCTGCAAAACCAGCTGGTGGCAAGCCT
GCTCCTATCGAACCAATTGTTGTTAACCGGAAGGCGAAGCTGTCGTCTGAAGTGATGAAAATGATTGACTCAGCAATAGCTGGTCTTGAGAATGGATATA
CACCAGTTATGTCAGCAGAAGGTTCAGGGGGTGTTTACTTCATGCAAGACTCATCAGGCCAGAAGAATGTTGCAGTGTTTAAGCCCATTGATGAGGAACC
TATGGCTGAAAACAACCCAAGGGGTCATCCACTGTCGACTGATGGGGAAGGCATGAAGAGAGGAACGCGTGTAGGGGAAGGTGCACTAAGGGAAGTTGCG
GCTTATATTCTCGACCATGCAGTTGGTGATCGTGAATCGGGCCACGGTGTTGGGTTTTCTGGTGTGCCTCCCACAGCATTAGTCCGAAGCTTACATAGGG
GAAAGAGCTTCAAGTTTGGATCTCTGCAGATGTTTATGGAGAACGATGGAAGTTGCGAGGATATGGGTCCCCGTGCTTTTCCAGTGAAGGAGGTACACAA
AATAGCAGTGTTAGATATTAGGTTAGCGAATGCTGATCGTCATGCAGGGAACATTCTAGTGTCCAAGGAAGAAGGTGCCACCTGCAAGCTGATTCCAATT
GATCATGGCTACTGCCTGCCAGAGAAGTTTGAGGATTGCACCTTCGAGTGGCTTTACTGGCCTCAAGCCCGTGAGCGGTTCAGTGATGAAACCATTGCAT
ACATTGAATCTCTTGACGCGGAAGAGGACATCAAGCTTCTCAGGTTCCACGGGTGGGAGCTGTCTTCGAGCTGCGCCCGCGTCCTGCGCATCAGCACCAT
GCTCCTGAAGAAGGGCGCGGCGCGAGGCCTCACACCCTATGACATAGGACGTATACTGTGCAGGGAGACTGTGAATAGAGACTCTGTGATCGAGGACATC
ATCCAGGAAGCGGAGGACGCCGTCCTCCCGGGGACGAGCGAGAACCTGTTCCTGGAGACGGTGTCCGAGATCATAGACCGCCACCTCCTCGGCAAGTAAT
ATCTGTTTAGAAACACTCAGAATAACTGATCTAGTTGTTCGGCTGTATCCGGTTTGCTGTAAGTATGTTTCACAGGGCACTGCCCCAGACATCCTCCTCA
AGGGACTAATGATTTCATTTGTTTCTAGCCCCGAACGATTCCGTTTGTTTGTAGCCGCTCAAGAACATTTCCTTCTGTGAATATAGATGTCTGTGCTGCG
TTAGACCTTATCACTGAAAAAAAAAA
page-top