Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig983  (registered. 2007)
Contig Information
Length 813 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group] >gi|125598025|gb|EAZ37805.1| hypothetical protein OsJ_021288 [Oryza sativa (japonica cultivar-group)] >gi|215766592|dbj|BAG98751.1| unnamed protein product [Oryza sativa Japonica Group]
Score 524
Evalue 3.6437e-78
Total Hit Count 219
Registered year 2007
Contig Sequence     [ Download ]
>Contig983
gtgcttttacaggcatgaaggttggtggtcttatgagttctgctattatgggaaaatccgacaggttcatgtagagaatgagaaggttatccaagAGTAT
GTCCTAGGTGAATATGACCCTGATGCAACCGATGCTTACCATGATAATCACACctcccgAGTCTGCTGATGAGGATCATGTGAAAGATACTTCTAAGAGG
TATCATGTCCATGTGTACACAAACGGGACTGTCTGTGATCTTACCGATATACCGCGGTACACAGAGGTTAGGTTTGTTTGTTCTGAGCCTACTGTACTGA
TCAGTTCGATAAAGGAGATATCTTCCTGCAAGTATGTTTTAACAGTCCAAAGCCCAATGCTCTGCAAAAACCCGCTGTTTCAGCAGGAAAAACGCACCTT
CTTCATCCACTGCAACGAGTCGCTTCCCGAAGCAGAAGGTGAGGTCGCCGAGGACGACGACTCTCTTCCAAAAGAAGCTCAGATGTCCATCGTTCCAAAC
CCCGACGAATTGCATAACTACGCAGCTTACGCTACCTGATTGCCCGCCAATCACGGTGCCCTCAGCTAATGAAAGATACCGTtatttttgGAAGTACAAC
AGCAAGTTGGCATCACTATCCCCTGGCTTGTTCTGTCTGACGCCAactagtggttacagggtgctctttgagcagatatccattaccgaaacaggttgag
attgccttagaggaagattaagggcaaagagtgtcttgctgtactatagtactgtagtataatttagtaaagggtgtgtttgagattgaanacagacatc
actaacaattttc
page-top