Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig981  (registered. 2007)
Contig Information
Length 435 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_05599 [Oryza sativa Indica Group]
Score 106
Evalue 0.00151835
Total Hit Count 70
Registered year 2007
Contig Sequence     [ Download ]
>Contig981
gccgccattgCCGCACTGTGCGTGCTCCTCGTCATGTCAGTGCCGCCCCAGCAGCGGGCGGCCGCCGAGACCTTCTGCGAGTGCTACCAGCCCTGCCACG
ACGGGTGCAGCCGCAGCGGATGGATCTGCAAAGTCGACTGCATCCAGAAATGCAAGGAAGAAGGCTACCCCGAGGAGAGCCGCGCCGCCTGCCTCTGGGT
CTGCAGCACCGACTCCGTCTGCGGCCCGTCGGCGGCGCCCACCGATGCAGAAGGCGCTGCGGCTTGTAAGCACGAGTGCCACAGGAGGTGGGGCCTGGTT
TAACGCCCAGCAGCAACCTGCCAAATAAGGAGCTGAATGGCCAGTGGATCATGGGGTCGTATCATGTTGAACGGCTgtgatTGCCAAACAAATCAATAAA
ATGTGTTTCCGCGcgtccgcgcatcaaaaaaaaaa
page-top