Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig978  (registered. 2007)
Contig Information
Length 660 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit proton myo-inositol cotransporter [Zea mays]
Score 183
Evalue 5.88868e-19
Total Hit Count 260
Registered year 2007
Contig Sequence     [ Download ]
>Contig978
aggaattcggcacgagggcGGTCGGGGCGGCCGGCAACCGCGtggtgaGCGGCGTCATGTCCATGACCTTCCTCTCGCTGTCCGGCGCCATCACGCtcgg
gcGGAACCTTCTTCCTCTACgccgggcGTCGCCGTGCTCGCGTGGGTGTTCTTCTTCACGTgt*ctCCCGGAGACGCGCGGCCGGACGCTGGAGGAGATG
GGCAGTCTGTTCGGCATGACCGACACGGGGCCGGAGGCAGAAGATGCTGCCCCCGGGACACAGGACGCGAGCTGCAGGGCGAGACTCTTGATTAATCACA
TGAATATTTGGGGCTCAGTACATAGAAAGGTGTGTGTAGGACACATCTAAATGTTATGTCACGTCTAATCTGATGTTCATTATGTTTGTGGTTTACTTTA
TTTTGTTTGTTGTTGTTACGTTTATTTGTGAGAGTTTAGATGCGACATCCTTAGAAAACATTTAGATGTGAATTAGACAAACTGAGGTTTATATATGACA
CATCTAGATGTGACATCTAAGCTAATGTCCACTCTGTTTGTGGTCAATTTTTTTGTCCTATTTTTTATTGCTGCATTATATGTTTGTGTGAGTTTAGATG
TGACATTCTTAAAAAATATCTAGATGTGAATTAGACAAACTAATATAAAAATATGCCgcc
page-top