Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig974  (registered. 2007)
Contig Information
Length 906 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein binding protein [Zea mays]
Score 945
Evalue 3.24625e-100
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig974
gctacattccaatatttgctcttttctccccactatttattctacaaggagctggtgtccttttctcgataggaagattggtggagaaagttgttctgct
attgcgcaatggaccagttagtccgaattaccttacagtatcatcaaaagtccgtgattatttcgcttttcttcatcacgggtcaaggcttctTGGTTGG
TGGTCTATTGATGAAGGGAGCAAAGAAGAGCAAGCTCGGCTGTTTTATACTGAATCTAACGGGTACAATACATTCTCTGGTTACCCACCTGAGGTAGTAA
AGAAAATGCCCAAGAAGGATTTAGCAGAAGAGGTTTGGAGACTCCAGGCAGCGTTGGGGGAGCAATCTGAAATCACCAAGTCTACCCAGCAGGAATATGA
AAGGCTTCAAAATGAGAAGGTACTTTGTAGGATTTGCTACGAGGGAGAAATATGCATGGTCATACTTCCCTGCCGGCACAGAACGTTATGCAAGTCATGT
GCTGAGAAGTGCAAAAGATGTCCAATCTGCCGTAACCCCATCGAGGAGCGCATGGCTGTATATGATGTTTAAACCTTGCTAACTAAGCTGAACATTGCAA
ATCTGTACATGTGGGCTGTGTGATGTGCATATGTGCTCCGATCACAACTTTAAGCTGATTGAGGTCTGCAcaactccagaaaagttcagcaatatggaga
aaatatatcttgtctaaccaaaaggaaggaaaagatagctgctgagcattttcgggttccagttatgtactatcagtctgtaagtatgtcaccttggctc
ctttttgtgcctcatagatgttcccgtttgacttaggttgtgttcactgtaaataaaaatgtctcgtttgttttttgtgctcctnaccttagaaaagaga
gtaaat
page-top