Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7980  (registered. 2012)
Contig Information
Length 727 bp
Clones alternative view 84 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 8
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_VSCB Liquid cultured tissue 8
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_CA 4
WH_SP 3
WH_XA Root 5
WH_XB Root 11
WH_XC Root, treated at 50 microM Al for 6h 9
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242054163|ref|XP_002456227.1|| hypothetical protein SORBIDRAFT_03g032450 [Sorghum bicolor]
Score 254
Evalue 8.00E-66
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7980
TTTTTTTTTTTTTTTTGGAAGGCTTTTTTTTGTGGAAATGATTTCAAGAGGCTTCACAACATAGTCATGGGTACAGATATAGAACCTACTGAGAAAACTT
GGGCCAGTATGCAGAGCACACCATTCATCATATTCAACCTCCATACTCTTAGAACAAATCTAAAAAGCTGGAAACATAAACCAACGGATCCACAAAACAA
GCTCATTGGCCCCTCAGTGCTTACTGCCTGTTCTTCTTCTTGACACCGGACTTGGCAACCTGGAGGCTGCGGTAAACTGCGCTCAGTCTTGCAAGAGCAG
GCTTGGTCAAGTCAGGCCTGTAGTAGTTGTCACTGACCTGGTTCTTGACAGCCTTGGCCATCTTGCGGAACTCCTTGCGCATGACAGTCTTGTGGGTGAA
CGCAGCAGGCTTGTTCTGCTTCTTTGACTTGGTTGTGGAGAGGACCACAGTCATCTCCTTCTCAGCAGCTGGCTGCACCGTCACAGTCTTCTTGTTTGCC
AGGCCAGAGTACTTGTAGGAGTGGACATTGTAGAGGTTGTTGGGCTCCTTGCTGAACTGGACCTTGGCATTGCTGTTGCCGAACTGCTTGATCAGGAAGC
AGTTGTTCTTCCTGACAAGCTCCCAGACCAGAGAATCCGAAACCGTCGCCATTTATCCTAACCGGTGATTGGAGTGACGCGCCGCCGATCTGCTTCGTCC
CGGGGTTCGTGTGTGCCTCGTGCCGAA
page-top