Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7971  (registered. 2012)
Contig Information
Length 1549 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 1
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23℃ 6
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XA Root 6
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115479081|ref|NP_001063134.1|| Os09g0407200 [Oryza sativa (japonica cultivar-group)]
Score 613
Evalue 2.00E-173
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7971
TTTTTTTTTTACCTGAAGAAACAGCCACTTCGTCTATCACTAGTTTTTTTTTTCCAGTAAAAACTGACAGAGAACTTTTATACGCTGTCGTTAAGTCTGT
GAATTAACATTTAAAGACGATCTAGAGTATGTACTAATAGCAAGGCAGAAAAGAATTACAAACTAAAGGACGAGACAAAATCTCAAAAAGATCTCTAAGG
CCTGCCCTGCGAGTGCAGGAGTATCAGTCTCCCCACACCCTTGTTCCCATGGGCTTGTGCATGTATTCAGAAACAACCTGCTTTGTCTTACTGCGGCGCT
CCGTCGTCAAACTCGTTCATGTGGTCTAACAGGTAGTTTGCGGCCAGGGTCTCGTCCTTGTTGCAGGCGAAGTACACCTCCAGAACAAGCGCCCGGTCAA
AGCCCATTCCTTCAAGACGAAGTATAGCTTCATTCTCCTCAGGAGTGACAGCTATGGTCTGAGGCACACCCTCAGCAAACTGCTCTAGTAGATTCTCGTC
TTCATCGCCCTCAGCTGGCTCATTGATTAAACGAAGGAACTCTGCTTGGTTGTCCTGAATCAGCTGCAAAATCTGAGGGTTTTGCTTTCCCAGCTCTTGA
AGCAATGGCTGTAAGATTTGAGGGTTGGCCTGCACTAAAGAAAGTAAGCTTCGGAATTGTGCATTGTTACGCAAAACATCCAGATTTCCTTCACCAGCAG
CATTTGCTGAAGCATTTGGCAGGGCTTGAGGGAAGAGGTCCAAGGGGCTAGCGTTAGGACCGGAAGAGGCAACTGCAGGTTGAGCTGCTTGTGAAGCCAG
GGCAGGATCAGCTGGCTGGGCACTTGGTGGTGGTGCAGGAATCTCCATCGGCTCAGGAATACCAGAATATAAATACTCAACAGCCCGCTCCGGGTTGTTG
AATGCAGCACGTAGGGCACGCAGCACAGTGTCTCTGTCCCATGTTCCACCACCCATTTCAAGAATTGACTGAATTGTTGCCTCTAGGGTGCCTCCCGCGA
CAAGGTTCGAAGCAGCCTGACCATAAGTTTCTGCTTCAGTGGAGACAGCAACAGCAGGAGCTGGGGAGGCGGTGGCAGCTGGACCAGGAGCACTGACAGG
TACAATAGGTGCTGGCGCAGCCACTGCTTGAGGTGCTGGCGTGGCTGGTGCTTGAGAGGCAGGAGTAGCAGGCACTGTCTGAGTAGGGGGTGCCTGATTT
GAGGGTTCCTTGGATTTAGATGGAGCTGCACTTGATGAGCCCTTATTCTGTCTAAGCATTATCACAAGAAAGTTGTTTTCAACAACTTTGTTTTCCTCCA
ACGTAGTCTCATCCTTAAGAACTGTCCCTTGGTATATGAGCATTTGTTGATCAGCTGGGTACACATTCTGCCCTTGTGAACTCTCAATGAGCTTCTTTAC
ATCAGAAACCTTGTCGGCGGGGTTCACTTCGATCTCGAATTTGGAGCCCTTGAGCGTCTTCACGGAGACCTTCATCTCGCCGCCGCGCGCGCGTGCGTCG
GTCGCGGCGCTCGACGAGTTCGAGAGGAGGCGGAGGCGGAGGGGGGGAG
page-top