Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7963  (registered. 2012)
Contig Information
Length 762 bp
Clones alternative view 59 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 5
Wh_f Spike at flowering date 3
Wh_r Root 6
Wh_yd Spikelet at late flowering 11
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 2
Wh_VSCB Liquid cultured tissue 7
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_SP 12
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122044864|sp|P05621.2|H2B2_WHEAT|H2B2_WHEAT RecName: Full=Histone H2B.2
Score 278
Evalue 6.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7963
CCAGCAAACTCACACATCTCACCACCGGAGCTCCCAATCCCACCCGAAGCGGCAGCCATGGCCCCCAAGGCAGACAAGAAGACCGTCGCCGAGAACAAGG
TGGAGAAGGCGGCGGAGAAAACCCCCGCCGGCAAGAAGCCCAAGGCCGAGAAGCGGCTGCCGGCGGGCAAGACGGCGTCCAAGGAGGCCGGCGGCGAGGC
CAAGACGAGGGGCCGGAAGAAGGGCAGCAAGGCCAAGAAGAGCGTCGAGACGTACAAGATCTACATCTTCAAGGTGCTGAAGCAGGTCCACCCCGACATC
GGCATCTCCTCCAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGCGAGTCCGCCAAGCTCGCGAGGTACAACAAGA
AGCCCACCATCACCTCCCGGGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGCGAGCTCGCCAAGCACGCCGTCTCCGAGGGCACCAAGGCCGTCAC
CAAGTTCACCTCCTCCTAGACTGACGGCGTGTAGTTGGTTTCTGTATCTGTACTCTGCTTATCTATCTATCTGCAAGTAGCGGTAGCAGTACCTGTGCTG
GGTGATTGCCAACGCTTTGTTGGCTCGTTGGTTGTAGTAAGAACTCAAGTTGCTGCTTTGGCAAACTGAAATCTATCTAGAACTCAAGTTGTGTTCCTAT
ATCTGTACTAGTGATCTTGCCTGACTGATGTTAGCTTTTGACCCTTCTGAAATGTCTGGCCA
page-top