Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig278  (registered. 2007)
Contig Information
Length 719 bp
Clones 1 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit extensin [Hordeum vulgare]
Score 353
Evalue 9.43115e-32
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig278
atggtttactgtgacactggcacattgccacgctagcaacacagacgctaagactggacgaacacaaatgataagctggtnagatnactaatgggagcca
tctgcattattccatctnctcagagatcggccctagttcggcagcaacacacaccggaggaggatcaacgacgccgtacgtggctcttcttggcctgctc
gcacaactcttctngaccgcatcctgggctcccaacttcacagagtggtggatctttttagtggtggtacggcatgaggcggggggctcggggtgggggg
cttgtacgccggaggagtaggcgtcggcggcttgtagggcggtggagtcggcttcggcgccggcggagtcggcgacgtcggcggtgagggcttggggaca
ggcttgtacgccggcggtgagaccttggggacaggcttgtgcgccggcggtgagaccttgggggctggcttgtacgccggcggtgagaccttgggggctg
gcttgtacgccggcggtgagaccttgggggctggcttgtacgccggnggtgagaccttgggggctggcttgtacgccggcggtgagaccttgggggcggg
cttgtacgcctgcggtgagaccttntnggcagncttgtactccggcnggtgagaccttggggnctggnctttgtactccctgcgtngagacctagtgggc
tggctttgtaagncggcgg
page-top