Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig791  (registered. 2012)
Contig Information
Length 652 bp
Clones alternative view 112 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 3
Wh_oh Pistil at heading date 2
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 8
WH_XA Root 3
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 14
WH_XF Seedling, infected with leaf rust 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig791
TTTTTTTTTTAATTTTTTTTTTCCCCACCAATCAATTGATTGATTAATTAATTAATCAAAGTTCAAAGTACATGGACGACGAAAATGCGCGGAGGAACAA
CACAAGTGGATGGATGGATACACTACACTGGAGAAGGGAAGGTGACAGGAGAGGAGGCTAATCATCAAGCACGGACAACAACACAGATGTACAACAGCAT
GAACACACACATGTAGGCAGGCAGCACCATGAACCGTGGCTCGCGTCTCGGACAAACGGCTTGTACCAGACACAGAACAAGTTCGACATGGATCACCTAG
AGGCAGAGGTGAGGAGCCCCTCCTGCAGTCCTACTTGGTGATGACCCAGACGGCGTAGATGATGCCGGGGAGGTAGCCGAAGAAGGTGAGCAGCAAGCAG
ATCCAGAACTCGATCCCGCAGGCGAACTTGAAGAAGACGCCGAGCGGCGGCAGGATGATGGCGAGGATGATGTCGATGCAGTTGGCCGTCCCCTCGTCCG
CCATCTTCCTCGTTCCTTCTCTCTCTCCCTCTCTCTCGAAGCGTCGAAGGGAAAGCCAAGGGAGATGATGTGAACAAGGAGGGCGAGACAGGTAGGTGGA
GTAGAGTGATGTGGTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTA
page-top