Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25427  (registered. 2003)
Contig Information
Length 2237 bp
Clones 1036 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 96
Wh_KMV Shoot grown with continuous light after cold treatment 85
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 8
Wh_PCDAM Anther at meiosis 29
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 35
Wh_V4816 Shoot grown under cold condition for 16days 148
Wh_V483 Shoot grown under cold condition for 3days 166
Wh_VABA Shoot with ABA treatment 104
Wh_VHS Shoot with heat shock treatment 233
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 118
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit [Triticum aestivum]
Score 814
Evalue 1.73612e-84
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25427
TAGAAGTTGTATGCAATCCATAACCAGCACATGCAACTCAAATACCCACAATTCAAACCCAAAATGTTCCAAACTCAATACTCATGGACTACATTTCGAG
TTCTTGACAAAAGCAAGACAACACCATCCAAAAGCCATGCGAGCAGATATTTTACATAACAATAAATACTCAGACGCGTGAACACCCAGTGGGGGTGAAG
ATGGACTCTGCTCAAGACACCTTCTGACTGTCTCAAAAAGTTCTCAGCATATTTCATCGTCAACGACTACCAACTTCCGTCAACAGGAAGGACCGACAAA
CTGACTCTTGCCACCGAGCAATGCTCAGCGGTACCATTGTGACGGGCGTTGCTCTGCCCACTACTCTGAGGGGGCTGTCGCGGCTTTGGTTTCTGTCTCC
TTGCTAGCATCAGTTGATTCCTCCTTAGCTGCGCTTTCCTCAGGTTTGCTTTCGCTTACACTAAGTTTCTCCAGCAGTCCAGCTGCGGAAGAACCTTCTT
CGCTTTCACCGCCTTCATTCTTTGCAAGCGACTCAGCGATCTCATCAACTAAGTCTTTAAACTTCTTGCAATTCTCAACGGTGCCAAACCGGATGGCAAA
CATCTCATCCTTAATTTTTTTTTACCATTAAAACGTATATAGTCGACATATTGTATAATATTATGCGTTCCGCTGCATATACATAGCCCACCGCATAGGC
ATTCACATACGAGCCATGCTTTTCTCGAGCCATGCTTCGTACATGAACATGGCACATACACATATTCTTAGGAACAAATAAGAAAGATAAATGGAGAAGG
AAAACCCAAAGCAATGTCAGAGTTGACAAAACTGCAATGGCACTTTATATATGGCCTGTCGTGAGTGAGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCC
CGGTGGCTTGAAGGCGATGAAGCTGACGCACTGCACCTGACGCATGTTGTCGAATCCGATGATGCGGACATAGGCGTCAGGGTACTCCTTCTTGACCTCC
TCCACCTCGTTGATCACCTGCGTGGCGTCGGTGCATCCGAACATAGGCAGCTTCCACATTGTCCAGTACCGGCCATCGTAGTACCCAGGGGATGCGTTGT
GCTCACGGAAGATGAACCCAACCTTGCTGAACTCGAGGCAAGGCACCCACTTGGAGCGGATCAGGTAGTCGACCTGCTTAAGGAGGGCCTCCGTGCTGAG
CGGTGGCAAGTAGGACAGGGTCTCGAACTTCTTGATGCCCTCGATGGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGCTGACGCTGCCGAGGCTA
GCGCCGTTGGAGCGGCGGCTGAGCGGGGAGGCCGGCGGTGGAGCTTGAGCCCCTGGAAAGGAGCGAACGGAGGTGGCCGACGAGGCCATCACCGGTGGGG
GCCCATGGCCTGTACCTATGTAGGCCCACCTAGTCCAGCATGAACAGCTACTATTACTACTTGGAGGACTCGCGGCAGTGGTTCTGGTGGAGCGGCGGCT
GGCGCACAACTAACGATGGCAGACGTTATCCTGCAGTTAATATAGTTATATTAACTGAGGTCTCCTTCGAATATGTGTTCGGCAGAAAACCATTAACCGA
ACCCCCTCAGGATAGCTCTCCCGGAATTGTGATCTCGATCAAAGATATGGATGATTGGCAATTGCGTTGGGACAATTCTGCTCGATACAACAAGCTGTTG
GTGTATTCGTTCTACGACAAGAATTCCACACTGTCCAAGGCCATGGACAAGCTGTTGGAGAAACTCGCCAAGCAGTATAAAGGCAAGGCAGACTTCTGCA
AGTTGGACGTCGACAACTTCGAGTTTTTGGCGGGGCTTTGCGGAGTGGAGGGAGCGTATCCGACGTTCGTGCTATTCAAGAAGTGCAAGCAGGTGGGCAA
GGTCGTCGGCCTCAAGGACGACGAACTCGAGCGGAGCATCGAGCGAGCGCTAAACTAGTACTCAATGTTTTTCGTGTGAAGGCTTATAATATGGCCTTCA
TGCTACAGAACTACTATATGTAGCTGGAATAAGCATGGTACGAAACTTGTCGAGAGATGTTGAGTATCAGATGTACTAGTCCATGGACCTATATGCTCCG
GCATGATATGAGCTACTCCCCTCTGTAAACAAATATAAAAGCGTTTAGATCACTACTTTAGTGAACTAAACGCTCTCTTATATTAATTTACGGAGGGAGT
AGAATTTTAGGAGACGTAAATATTAAAAATTCCATAG
page-top