Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25404  (registered. 2003)
Contig Information
Length 892 bp
Clones 295 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 24
Wh_DPA20 Seed DPA20 12
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 7
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 13
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 11
Wh_KMP Shoot grown under continuous light 34
Wh_KMV Shoot grown with continuous light after cold treatment 12
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 29
Wh_PCDAM Anther at meiosis 19
Wh_RDr Root of dessiccated seed 14
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 12
Wh_V4816 Shoot grown under cold condition for 16days 15
Wh_V483 Shoot grown under cold condition for 3days 28
Wh_VABA Shoot with ABA treatment 18
Wh_VHS Shoot with heat shock treatment 7
Wh_VWD Shoot grown with dessication 19
Homology (BLAST) Top Hit cyclophilin A-1 [Triticum aestivum] >gi|13925737|gb|AAK49428.1|AF262984_1 cyclophilin A-3 [Triticum aestivum] >gi|156193317|gb|ABU56010.1| cyclophilin 5 [Dasypyrum villosum]
Score 816
Evalue 2.86144e-85
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25404
TTTTTTTTTTGAATCCAACGAGCACAAATTACGGATAATTCATAGCGGAGTTCATCTCATTCAAACGGTAAGATAGCAGCAGACACAGGAAGATAACCAA
GGCCGCCGGACGCAGATCCAGCGGCCCAAAGAGTCCACCTAAAACCCTCCTAAACCAACCACGGAGATCTCATCGGACGGACCAGGGGAAGACACGACAC
ACGACTCTCTTATTTAGATCGACGACACGACACGGGACACACGGGGCGATGACGACGACGGCGACCGGCGGGCGGGCGGATCTAGAGCTGGCCGCAGTCG
GCGATGACGACCTGCTTGGAGCAGGTGCCGCTGCGGGAGCCCACCTTCTCGATGTTCTTGACGACGTCCATGCCCTCGACGACCTCGCCGAAGACCACGT
GCTTGCCGTCGAGCCAATTGCAGGGGACGGTGCAGATGAAGAACTGGGAGCCGTTGGTGTTGGGCCCGGCGTTGGCCATGGAGAGGATCCCGGGCTTGGT
GTGCTTGTGGACGAACTTCTCGTCGGCGAACTTCTCGCCGTAGATGGACTCGCCTCCGGTGCCGTTGCCCCTGGTGAAGTCGCCGCCCTGGCACATGAAG
TCGGGGATCACGCGGTGGAAGGCGCTGCCCTTGTAGTGCAGCGGCTTGCCGCTCTTGCCGACGCCCTTCTCGCCGGTGCAGAGCGCGCGGAAGTTCTCCA
CCGTCCGCGGCACCGCGTCCTTGTACAGCTCCATCACGATGCGCCCCGCCGGCGCGCCGCCGACGGTCATGTCGAAGAACACCCCTCGGGGTTGGCCATC
TCGCTCGCCGGGATCGGGGATGAGGGCTAGGGTTTTGAGATGGGGATTTCTGTGCGGATTGGATTACCTTTGGCTTCGCCTCGTGCNGAATT
page-top