Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25401  (registered. 2003)
Contig Information
Length 3418 bp
Clones 286 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 29
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 31
Wh_KMP Shoot grown under continuous light 3
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 34
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 6
Wh_V4816 Shoot grown under cold condition for 16days 27
Wh_V483 Shoot grown under cold condition for 3days 30
Wh_VABA Shoot with ABA treatment 43
Wh_VHS Shoot with heat shock treatment 14
Wh_VWD Shoot grown with dessication 63
Homology (BLAST) Top Hit phosphoethanolamine methyltransferase [Triticum aestivum]
Score 2113
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25401
TTTTTTTTTTGCTGTGAGGTCACAGAAACCCCACCAGAGTGAAGAAGGCCACGTAGAAACAGAATAGCACGTTACAAAGCGAGTCTCGCTCGGTCACAGT
ACAAGTTCAGGAATACAGCACGTACGCTACACATTTATCTTATCTTACGGATCCTGGGTGCCCAGCCAGCTGAATGCAGCCACTGCAACAAGCAAACAAT
CACACCCAACACCACACGGCCGCAGCACGGTGGAGCACCGATCCTCTTTATTTATTTCTTAACCGAAGCCGCTCTGCTCCCGGATCATCGCGTCGCATGG
CGTCGCTGCTCGGCGTCCAGATCACTTGGTCGCGATGAACAGCCCCCACTTCTGCTCGCCGGCGGAGCTCCGCTTCAGCTTCGCGCTCCAGCCGTTGACG
ATGTCGTCGTAGTCCTCCTGGGTGAAGTCCGCCAGGAAGGCCTCCTTGTTCTTCTCGGTCTCGCCCAGCTCCCTCTCCAGGACCCTCAGGAACTGGTCGG
TGCGGTCTTCGGCGACGACATCGTGGAAACCGGCATCCTCAAGCATCTTTCCATAGGTCTTCACGTCATGGAGGTCATAGCCTCTCTGCTTGATGTATGC
AGCAAATTCCTCTGACGGTGTCCCAGGGCTCCTGCAGTAGTCACTGATCAGCACTTTGCCCCCAGGCTTGAGCCACTTGAAGAAGTTTCTGAACAGAGCG
GGTTTGTCTTGAATGTGGAGGATGGTGTCACGGCTGTAGATCACATCAAACGTGTTCTCTGCGTATTCCTTGGTGGTGCAGTCAGCAACCTCAAACTCAA
CCGAGCACGAGCGCCCGATGGCACGCTCGATCGCGAACGAAACCATGTTGATGGAAAGATCGATGCCGAGGACATGGACATCATAGGTTTCAGCCATGTA
GAAGTCACCTCCTCCGATGCCGCACCCAACATCGAGCACCTTCTGGCCAGCTTTCAGATCCAGCTTGTCCACAAATTCTTTTGTGGTCTCGAATCCACCG
GTGCTGACATAACCCTCCCCAAACACGCGCTCATAACGCAGGATTCCAGTGGATTTGTACTGCACATTGTCCAGGAATCTCTGAAAGCCTTTGTCTTCTG
TGCACTTGACCTTCTCCCATAGCCAACATATCTGGTTCTGGTTCTTCTTGCTCTTCACATAAGCTCCAATGCACTTGGAAGTTACCAGAGAAAGCTCAAA
GGAATTCCCATCTTGGTCATAGGAGTGGCATTCCTTAAACACCTTGGTGTAAAACCTTGGCTCCCGGTAGTGCGTCGGGTTCACTTTCCTCTTGGAATCC
CCAGACTGGTGGAAGCAGGACTCCCTGATGAAAATATGCCCACCGGGCTTCAGCCACTTCACTATCCTGCCAATCAGCTTCTCAACCTCCTCGTCGTTGA
GGTACATGAGCAGCCAGTTGGAGAAGACGATGTCAATGGAGTTGTCCTCGATCTTGAGCTCCGGCGAGGTGACGTCGGCGCACATGAAGGTGATGTTCTT
GTAGATGTCCCCCATTGATCTCCTCGTTCTTCTTGATGACGCTGTCGATGAAGTCGAGCGCGATGACGTGGCCGGCCTCCTTGGCCAGCTCGCCGGTGAA
GCGGCCGATGCCGGCGCCGAGCTCCAGCACCGTCTTCCCCGCGTACGACGGCAGGATGGCCAGCACCTCTGGCCTCTCCTCCTTGTCGAGGTCCTTGGCG
CGGGAGTCGAGCATCATGGACTCCACGGTGAGGTCCTTGGAGTGCTCCTCCCAGTAGCTCTTCTGCACCTTGCGCTCCACCTCCCCGAACACATTCTCGA
CGACGGTGATGGTGTCCATCTTCTTCTCTCGTTTCAAAGTTTTTCAGAGGCGAAAGGAAGGGAGCAGGGGAGTGTCGTCGTTGGGTGTGAGCTCTGGTGT
GTGTTTGTTGTTAAGAAGGTGTGGTGTGTGTGTTGGCTGGGCCGGGGGTGGCGGTGGGGTTCTGTTTAGGCGCCCTCGACGGCGAGGCGGGATCGGGAGA
AGCCGCGGGAGCCTGCGGTTGTTGGAGAGGCCCCTCTGTTGCATGCACCAACGCGCAGCCCGGAAACCTCCCGACGCCGCCCGCGGCTGCGGAGGAGGAG
GAGGAGGTTCCAACTTCCAACGACCGAACGACCAGGGAGCGGAGAGCACCAAGAGTGTGCCTCGTGCCGAATTCGGCACGAGGTTTTGACAGCGTCTCAA
AGTGGGCATTTCCTCTAGACAAGTTCACTGTAATATGTACAAATCCTGGAGGTATATGTGCGATTCGCACAAAAAACTACACCGCTACATCTAAGAACCC
CCCTAACATTGGAGCTGCTGTTAGACTTACACAATGTAGGTCTTCTTCGGGGCTTTCCTGCCACGCTTCCTGTTCGGGCTGCATGAATCAGCCATGAGAT
TAAAAGCATTAGCAAATTCCTCGTCTTCGTTGTTACAAAGTATTCTAGACTTTTCAGGGTTTTCGAGCAGCAGCTTGGCCACAAGGAAGCCCGCAATGGA
CCACGTTTGGAATAGTCGAGCTTGTTTGCCGATGAACCGCCCACGCTTAGTATCGTAGTATTCAGGCCATTTATCCACGGAAATACGCCTCTCAGCCACC
TCCACGGCTCTTGCTGCAATCTCAGGCCGGTTCATCTTGATACATGCCACCGTGAGCTGCCACAACAATGTTGGCCAGGAACCTGCATTATGGTATGACC
AAGGCGTGTTTTTAGGGTCACTCCCTGTAATGTATTTCCACTCTTGATCCTCGAGAGCAGGATAACATATCTTCAATGGCATTTCTGCCACTAGATCAGA
CCATTTGGCTTCAACTAGATCCAGAATAGCATGGGATTGACGGGTTGTTGCCAAACTGCTTACTATAGACCACAAGTTCCCCAGAGAAAAGAATCGGAAA
TCCATGTGAGCTGGTTGCAGGTTTCCAATTAAGTAACCCCCTTCCGGAGGGATCCATTCAACTAGCCAGGGGGGAATCTGATCAGGATATATGTTAAACT
TGTTGACAGCATCATAAGAATATTCTTCTGTTTTGTATCGATATATCTCATTTAGCTTTCTCTTGTCAAGCCAGTAATATTCCCTAATATGAAAAGAGAG
CGCCATAAGCCTGTTATTTAGGGCACGGATCAAGTCAGCAGATCCATCTTCTGGGGTAAGCATCTCACGTGCACACAAGAGGGCTGAATAGAACAGTGAC
TGAATCTCCAGTGGGTGTCCATGGATACCCATTCGACGATCCATCATGCAGGATCCATCAGTGACTAGCAATGTGGGGAACATGTCAAACCCATCAGCTA
AGCAGAGCTTCAAGATCAATTTTATTCCAGTCTGGACATCGATTCTCTCATGAAATGAAAGATCTCCTGAACATTTTCCGTATGCCCTCAGTAATATGAT
CCACCATAGACCCTGAAT
page-top