Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25400  (registered. 2003)
Contig Information
Length 2148 bp
Clones 282 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 33
Wh_KMV Shoot grown with continuous light after cold treatment 12
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 3
Wh_SHDr Shoot grown with dessication 11
Wh_V4816 Shoot grown under cold condition for 16days 25
Wh_V483 Shoot grown under cold condition for 3days 41
Wh_VABA Shoot with ABA treatment 30
Wh_VHS Shoot with heat shock treatment 95
Wh_VWD Shoot grown with dessication 29
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit [Triticum aestivum]
Score 830
Evalue 2.30585e-86
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25400
CATGCTCATTATGATTATACATAATGTTTCTTACGGGAAAATGTGCAACATCCAAATCACTCGTGTTGATTATGATTGGTGGAAAATATATTCATACCTC
GGTCGGATACATCATACAAAGTTACACCAAGGAGCATGTGTAATTAGTGCCATGAAACTGGAAATTAAATTATATTGAGGGAATAGCGAAACAGAAGGAG
GGCTAGGGCAAGCAGGCGCAGACACGCCTATTATCCTTTGTGGTCTTCTTGGTGGCACCACCCGCATCTCACTTGTCTCCTCCCATCCCGAGCGTGTTCA
TGACAGCGTCCTTGGCGTCAGTAGCAGCACCCACCATATTCCCGCCGGCCTGTTGGAAGACGTTTTCCTTGGGGGCGACCGGGGTATCCTTGGTGTACTG
TGCAGCGGTGTCCTGGACATGCTGTGCGGCCTCGGTGGACTTCTCCTTGGCAGCATCGGCAGTCTCGGTGGCCGTCTTCTTGACAGCGTCAGTCTTGTCG
CCGAAAAAGCTGCCCGTCTGGTCTTTGCCCTCGACGGCGTGATCCTTACCGGCTTCCACCGTCTCGGACACCTTCCCCATGGCCTCGTCGCCCATCTTTT
TAGCCGCCTCGGTAGTCTCGGAGGCAGCCTTCGTGACAGCCTCGCTTTTCTCACCAAGGAAGGCCCCGGTCTGGTCTTTTGCCTCAACGGCGCGGTCTTG
AATGGACTGCCCCGTCTCGGACGCCGTCTTGGTGGCGTCGCCGGACTTCTCTTGAAACCAACCAGACATTTTTGAAGTTGATGGAGTGTTGGTACGTACT
AATTTGTGGTGTTCTTTCCCCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGGAACGCGGACACAGGTGGTGCATGGC
TGTCGTCAGCTCGTGCCGTAAGGTGTTGGGTTAAGTCTCGCAACGAGCGCAACCCTCGTGTTTAGTTGCCACTATGAGTTTGGAACCCTGAACAGACCGC
CGGTGTTAAGCCGGAGGAAGGAGAGGATGAGGCCAAGTCATCATGCCCCTTATGCCCTGGGCGACACACGTGCTACAATGGGCGGGACAAAGGGTCGCGA
TCTCGCGAGGGTGAGCTAACTCCAAAAACCCGTCCTCAGTTCGGATTGCAGGCTGCAACTCGCCTGCATGAAGCAGGAATCGCTAGTAATCGCCGGTCAG
CCATACGGCGGTGAATCCGTTCCCGGGCCTTGTACACACCGCCCGTCACACTATAGGAGCTGGCCATGTTTGAAGTCATTACCCTTAACCGTACCTCGTG
CCGAATTCGGCACGAGGCTTCTCTCCTCCAACACCATGGCCCCCACTGTGATGGCTTCCTCGGCCACCTCCGTCGCACCCTTCCAGGGTCTCAAGTCGAC
CGCCGGCCTGCCCATCAGCCGCCGCTCCAGCAGCGCCGGCCTCAGCAGCGTCAGCAACGGCGGAAGGATCAGGTGCATGCAGGTGTGGCCGATTGAGGGC
ATCAAGAAGTTCGAGACCCTGTCTTACCTGCCACCCCTCTCCACGGAGGCCCTCCTGAAGCAGGTCGACTACTTGATCCGCTCCAAGTGGGTGCCCTGCC
TCGAGTTCAGCAAGGTTGGTTTCGTCTTCCGTGAGCACAATAGCTCCCCCGGATACTATGACGGTCGATACTGGACAATGTGGAAGCTGCCTATGTTCGG
GTGCACCGACGCCACACAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGCGTCATCGGCTTCGACAACCTGCGCCAG
GTGCAGTGCGTCAGCTTCATCGCCTTCAGGCCACCGGGTTGCGAGGAGTCTGGCAAGGCCTAAACTACGAGTTGAAACAATGGCCTATGTATGAAGGTCT
TTTGTGAACGTCACTTTTGTCCACGACTCTGCTGGACGACCAGAGCATATTTTTCATTCTATATGGTCTGTGTATGTATGTACGAACATAGGTTCTCGAG
CATGCATATGCAAATTCTAGAACCGGCTACACATATACAAAAACCTGTGTGATATTTATTATATACAACACGCGGACCATTGTCTTGCTGTTATTAATTC
ATGAAAAAGGTTCTTTATTTGGCACTGCAATGAATATGTCTCACAACT
page-top