Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25398  (registered. 2003)
Contig Information
Length 2285 bp
Clones 266 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 22
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 13
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 14
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 7
Wh_SHDr Shoot grown with dessication 12
Wh_V4816 Shoot grown under cold condition for 16days 52
Wh_V483 Shoot grown under cold condition for 3days 18
Wh_VABA Shoot with ABA treatment 51
Wh_VHS Shoot with heat shock treatment 14
Wh_VWD Shoot grown with dessication 53
Homology (BLAST) Top Hit phosphoethanolamine methyltransferase [Triticum aestivum]
Score 1920
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25398
TTTTTTTTTTCAAAGCTAATTTTTTTAAGGGATTAAAGCATTATTAAGGAAGGGACAAAGATGCTGTGAGGTCACACAACTCTACCAGAGGGAAGAAGGC
CACGTAGCAACAGAATAGCACGTTACAAAGGCGAGTCTCGCTCGGTCACAGTACAAGTTCAGGAATACAATACGTACGTTACACATTATCTTATCTTACA
GATCCGGGTGCCCGGCCAGTGCAGCCAGGCACCGATCCTCTTTATTTATTCTTAATAACAGAAGCGGCTCTGCTTCCGGATCATCGCGTCCACGGCGTCG
CTGCTCGGCGGCCAGATCACTTGGTCGCGATGAACAGCCCCCACTTCTGCTCGCCGGCAGAGCTCCGCTTCAGCTTCGCGCTCCAGCCGTTGACGATGTC
GTCGTAGTCCTCCTGGGTGAAGTCCGCCAGGAAGGCCTCCTTGTTCTTCTCGGTCTCGCCCAGCTCCCTCTCCAGGACCCTCAGGAACTGGTCGGTGCGG
TCCTCAGCGACGACATCATGGAAACCGGCATCCTCAAGCATCTTTCCGTAGGTCTTCACATCATGGAGGTCATAGCCTCTCTGCTTGATGTACGCAGCGA
ATTCCTCTGATGGTGTCCCAGGGCTCCTGCAGTAGTCACTGATCAGCACTTTGCCCCCAGGCTTGAGCCACTTGAAGAAGTTTCTGAACAGAGCAGGTTT
GTCTTGAATGTGGAGGATGGTGTCACGGCTGTAGATGACATCAAACGTGTTCTCTGCGTATTCCTTGGTGGTGCAGTCAGCAACCTCAAACTCAACGGAG
CACGAGCGCCCGATGGCACGCTCAATTGCGAACGAAACCATGTTGATAGAAAGATCGATGCCGAGGACATGGACATCATAGGTTTCAGCCATGTAGAAGT
CGCCTCCTCCGATACCACACCCTACATCGAGCACCTTCTGGCCAGCTTTCAGGTCCAGCTTGTCCACAAACTCCTTTGTGGTCTCGAATCCACCGGTGCT
AACATAACCCTCCCCAAACACGCGCTCATAACGCAAGATTCCAGTGGATTTGTACTGCACATTGTCCAGGAATCTCTGAAAGCCTTTGTCTTCTGTGCAC
TTGACCTTCTCCCACAGCCAACATATCTGGTTCTGGTTCTTCTTGCTTTTCACATAAGCTCCAATGCACTTGGAAGTTACCAGAGAAAGCTCAAAGGAAT
TCCCCTCTTGGTCATAGGAGTGGCATTCCTTAAACACCTTGGTGTAGAACCTCGGCTCCCGGTAGTGCGTCGGGTTCACTTTCCTCTTGGAATCCCCAGA
CTGGTGGAAGCACGATTCCCTGATGAAAATATGCCCACCGGGCTTCAGCCACTTCACTATCCTGCCAATCAGCTTCTCAACCTCCTCGTCGTTGAGGGTA
CATGAGCAGCCAGTTGGAGAAGACGATGTCGACGGAGTTGTCCTCGATCTTGAGCTCCGGCGAGGTGACGTCGGCGCACATGAAGGTGATGTTCTTGTAG
ATGTCCCCATTGATCTCCTCGTTCTTCTTGATGACGCTGTCGATGAAGTCGAGCGCGATGACGTGGCCGGCCTCCTTGGCCAGCTCGCCGGTGAAGCGGC
CGATGCCGGCGCCGAGCTCCAGCACCGTCTTGCCCGCGTACGACGGGAGGATGGCCAGCACCTCAGGCCTCTCCTCCTTGTCGAGGTCCTTGGCGCGGGA
GTCGAGCATCATGGACTCCACGGTGAGGTCCTTGGAGTGCTCCTCCCAGTAGCTCTTCTGCACCTTGCGCTCCACCTCCCCGAACACATTCTCGACGACG
GTGATGGTGTCCATCTTCTTCTCTCTTGTTTCAAGGTTTTTCCAGAGAGGCGGGAGGAAGGAAGGGGGCAGGGGAGGGGAGTGTGGTCGTTTCAAAGGTG
TGAGTGTGAGCTCTGGTGTGTGTTTGTTGTTAAGAAGGTGTGAGCCCGGAGGTGGCGGTGGGGTTTCTGTTTAGGCGCCCTCGACGGCGAGGCGGGATCG
GGAGAAGCCGCGGGAGCGGCGGTTGTTGGAGAGGCCCCTCTGTTGCATGCACCAACGCGCAGCCCGGAAACCTCCCGACGCCGCCCGCGGCTGCGAAGGA
GGATCGGAGGAGGAGGTTCCAACTTCCGACGACCGAACGACCAGGGAGTGGGGCGCCAAGAGTGTGGTGCCGAGTAGCACGTACCATCAAACAAACTATA
ACTGATTTAATGAGCCATTCGCAGTTTCACAGTTCAAATTGGTTCATACTTGCACATGCATGGCTTAATCTTTGAGACAAGCATA
page-top