Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25395  (registered. 2003)
Contig Information
Length 1156 bp
Clones 250 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 15
Wh_KMV Shoot grown with continuous light after cold treatment 12
Wh_SHDr Shoot grown with dessication 7
Wh_V4816 Shoot grown under cold condition for 16days 12
Wh_V483 Shoot grown under cold condition for 3days 35
Wh_VABA Shoot with ABA treatment 47
Wh_VHS Shoot with heat shock treatment 76
Wh_VWD Shoot grown with dessication 44
Homology (BLAST) Top Hit RecName: Full=Carbonic anhydrase, chloroplastic; AltName: Full=Carbonate dehydratase; Flags: Precursor >gi|558499|gb|AAC41656.1| carbonic anhydrase
Score 1107
Evalue 4.00137e-121
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25395
AACTCTTTCTTTGGTTGGGCTAACAGCAAAGCAGTGCCAGACACCAGATGGAGAACCGTAAGGACAAAGGGTAATAAAAGGGTAAACTGTTCATGAAAAT
ATTATTAAACTTATATATGATGTCTTTTGATCACAGGACGATCAAATTATGCATCACATGGTAGTACAATTCCTCGTCAGAAAATGGTAAAAGAAAAAGG
GTTCTATTGCTTATGGCGAATTCACATCGGGCCATCCCGGCATCCAGTACTGGAAAACAACGAGCTACGCACTCCATGGCATTGGATTCACATCGGTCGG
TCGGACGATATCTTGATATATGTACGCGTTTGCATTCGCATGTATATATAGGAGTTAACCCGCTGGGGAAGATTTACTGCTCCCATGTCTCGAACTTGCC
GGAGACGAAGTCGTAATGGCCGCCGACGAGCTTGAGGGTTCCGTTGGACACACCCTCCTTGACGAACGGGTAGGTCAGGAGGTTCTGCAGGGACACGTTC
ACTGCCTCCTTTTCGAGGACGGTGCACTGGTCATCGAAAGGCATGGAGGCGCACTCAGTCTGCACCTTCTTCTTGGCCGGGAAGCCGATCCTGACCCAGT
CCTCGACGAAGTGGAAGGAGTCGTCTGCGCCATCCTTGAGTGAGAGCAGAGCCTTGATTCCACCGCAGCGGCTGTGGCCAATCACCACGATGACCTCAAC
CTTGAGAGCACAGACGGCGTATTCGATGGCCGATCCAACACCGGCGTACTTGTTCTTGCAGTAGGAGGGGACCATGTTGGCGATGTTGCGGATGGTGAAG
GCCTCGCCGGGCTCCAGGCCCAGGGTGACCGATGGGCACACACGCGAGTCGGCGCACGCGAACACCATGTACTTGGGCGCCTGGCCGGCCTTGAGGGGCT
CGAAGAAATCGGGCTTCTTGTCGTAGACCTCGGTCTTGAACTTCTCGAACCCGGTCTTGAGGCGCTCCACGGCGGCGTCCATCAATGCGGGTGCGATCGG
GCGCGGCCTGGAGCGGGGGTGTTCCTGATGACGCTTGGGGCGGAAGGAGGAGGAGTTGGAGGGCGCGGGGGTGCCGAGGCTGGCGAGCGATGGTGGAGGA
GCGGGCACGGGGCGCGATCGGTTGCGTAGCACCAGTTAGCCGCGGCGGTCGACATT
page-top