Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25394  (registered. 2003)
Contig Information
Length 817 bp
Clones 237 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 23
Wh_EMI Dormant seed with water absorption after breaking 13
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 26
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 22
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 35
Wh_OKCS Seed DPA5 54
Wh_PCDAM Anther at meiosis 23
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 17
Wh_V4816 Shoot grown under cold condition for 16days 7
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 8
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit type 1 non specific lipid transfer protein precursor [Triticum aestivum] >gi|84617233|emb|CAH69212.1| type 1 non specific lipid transfer protein precursor [Triticum aestivum]
Score 493
Evalue 6.96627e-48
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25394
TTTTTTTTTTCAATAATTAGGAAAATAATTACTATTCATTAATTGCCTGAACAAGTAGGTCAGGCACATCACACGTTACACATCGGCTACACTAGAGTAC
AGCAAAGAGTTGACAGTTTCACTCACGCATACGGACGCATGCATACATGTCGCATAAATATATATGCACACACAGTGTGTGCGCAAGGTACAGACATGGA
CACAGACACACAGTGACACAGTACTGAAATAACACACGCAAGCAACTTCATTTTATTATTTAGTAGCTCAGTATCGTATGAGCACTCCATCAACGTAGAC
ATTAAGCTCCACACAAGCGCGTCCTTGCATGCACGTCGGAAGGGTTATATATTGAACTAGTTGACATTGTTGCAGTTGGTGGACATGCTGATGGGGAAGG
GCACGCTGACGCCGCACTTGCCGGGCACGCCGGAGACCTTGTCCATGTTGATGGACTTGATGCTGGTGGCGAGGCTCTTGAGGCACCTGCACGCTATCTT
GCGGTCCGGGCTGCTGCGGGCCAGGCCGTTCAGCCCCTGCACACCGGAGCAGCACTCCTTGCTGATCGAGGGCGCCTTCCCCGTCACGTACGACACGCAC
GGCGCGAGCTTGGAGTCCACCTGCCCGCACGACAGTGCCGTCGCCTCCCTGCCGGCCATCATTAGCACCACCGCCGCCAGGACCACGGCGGACACCACAG
CCTTGCTGTTGAGACGAGCCATCGATCGCTAGCTGGAAGTTCCTTAAGCTGCTAGCTAGGCTAGTGGGTGATCAGATGAGTGTCGGCGGTGTGGTTAAGC
TAGTGGACGGCACGAGG
page-top