Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25385  (registered. 2003)
Contig Information
Length 1083 bp
Clones 209 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 58
Wh_DPA20 Seed DPA20 10
Wh_EM Dormant seed with water absorption 16
Wh_EMC Dormant seed with cold treatment after water absorption 22
Wh_EMI Dormant seed with water absorption after breaking 26
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 7
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 50
Homology (BLAST) Top Hit Os06g0612800 [Oryza sativa (japonica cultivar-group)] >gi|158513163|sp|A2YEZ6|SAP8_ORYSI RecName: Full=Zinc finger A20 and AN1 domain-containing stress-associated protein 8; Short=OsSAP8; AltName: Full=Stress-associated protein 3 >gi|158513350|sp|A3BDI8|SAP8_ORYSJ RecName: Full=Zinc finger A20 and AN1 domain-containing stress-associated protein 8; Short=OsSAP8; AltName: Full=Stress-associated protein 3 >gi|51090916|dbj|BAD35521.1| putative multiple stress-responsive zinc-finger protein [Oryza sativa Japonica Group] >gi|51090950|dbj|BAD35553.1| putative multiple stress-responsive zinc-finger protein [Oryza sativa Japonica Group] >gi|113596106|dbj|BAF19980.1| Os06g0612800 [Oryza sativa (japonica cultivar-group)] >gi|125597847|gb|EAZ37627.1| hypothetical protein OsJ_021110 [Oryza sativa (japonica cultivar-group)] >gi|215679046|dbj|BAG96476.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215697574|dbj|BAG91568.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737658|dbj|BAG96788.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737696|dbj|BAG96826.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765570|dbj|BAG87267.1| unnamed protein product [Oryza sativa Japonica Group]
Score 743
Evalue 1.14288e-76
Total Hit Count 433
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25385
TTTTTTTTTTCTCAGGGGCTAACTGGCCTGAAGATCAGGAACACAGGAACCATTGACAAGGGGGAAAGACCATGGATATACCATAATAACAGACGACGAC
GCTTACTCGATACCATTACCGGTTGCGACTGCTAAGACAGACAGACAGACGGACACCAGGAGGAAACAGGAGTACATTACAGAGTGCTAGCCAAAATGCG
AAAGCCACAATACCGGTTACCGTTCCGCCGCGCAGAGAGACGACCATAAATAAAGCTTACACAACATAGCCAACAAGGAGACCGTTCGGACCTGGGGCTG
CCGCCGAGGCGCGTGTGCCCGTGCATCACGATTGCCCAACAACAACTAGGATTGCAGAAGCCAACATGATGAAAGGATAATGCAGCAAAGACGCACGATG
ACGAGGTAGCGCAGATTTGATTTGGGACCTTATGTTCTGCCGACCGTAGGGGGGCCCTTCCTAGATCTTGTCGAGCTTCTCCGCCTTCACCACCGGGTTG
GCCTTGGCGATGGCGTCCATGGCCGCGGCGCGGTAGTCAAACTTGCACTCATGCTTGTCCGAGTAACGGTGCGTCGCGCAGTAGAGGTTCCCGCACCGGC
AGTTGAATCCGGTCAGCCCGACCCTCTTTCTGCAGGTGCTGCACCGGCTTGGGCCTTTGGGGTTCTCCATCGCCGCCTCGCTGGGACCGGCGATATCAGC
AGGCTGTGCGGTAATAAGCGTCTTCGCCTCTACGTGAGCAACTGCCACCGCCGTGTTGCCAGCAGCAAGATGTTCTTTCGCGGCATCACCACCGTTGACG
ATGCTGTCAAAAGAGGAGGCGGCCAGCTTGGCCTGCTCCTGCTTCATCGCCATCTCCTTGTGGCACTTGGAGCACATGTTCATGGTCGCCGCACTGCCGA
AGAAGCCGCAGTTATTGACGCAAAGGATGGGGCCCTCACGAGACTGGCAGCCGGTCTCCTTGTGCTCCATGACTTTGATTTAACTGATAGGAGGAAGCCC
TCGTCGCGATTCCTCTCCGGCGATCCCCTAGGAGGGGGAGGAACGAGGAGGCGAGGGGAGAGGAATCGCGAAGAATTCGGTCG
page-top