Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25378  (registered. 2003)
Contig Information
Length 703 bp
Clones 200 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 32
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 27
Wh_OKCS Seed DPA5 5
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 30
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 20
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 51
Homology (BLAST) Top Hit metallothionein [Triticum aestivum]
Score 271
Evalue 2.872e-22
Total Hit Count 348
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25378
TTTTTTTTTTAGCAAAGAGCTGGCGCCACACATATAGTGATACAGATACACATGCATACATAGAGAGAAACTCCAAATTATTGTTGTCTACATATATGTA
GATAAAACGGGAAGGCACGGGACGGAGCTTAGAACAGTAGGAAAAGGCGCGTCACAGACACAGGACGTACGCGCGCCTTGCACACCACACGGCTACAAGC
CACAAGGGGCCATGAACTAGCTCGATACGATACGATACGATACGATAGATCTCGTCTTATTCTCGGCGGCAATTAAAAAGAGAACACAAACGCACACACC
ATGCATAACTACTACTAGTGCTCCTTCATTAGGTCCATCCATGCCATGCCATCTCCTTGTCCTGATTTGATGGATCACTTGCAGGTGCACGGGTTGCAGG
TGCAGTTGGAGCCGCACTTGCACCCGCCGTTGTCGGCTCCGGTCTCGGCGGCGGCCTCGAACGACGGGGTGCCCTTGGAGGGGGCGACGCCCATGATGAG
GGTCTGGGAGGTGGTGGTCACCCCCTCGTCCATCTCAGGGTACATCTTGCACCCTCCGCAGCCGTTGCCGCACTTGCAGCCGGATCCGCACCCGCAGTTG
CCTCCGCAGCACGACATGGTTGGTGATGATCTACTGCCCTCGAGTTTATCCGCTCTGCTCTGTGTCTCTGGTCTGATCCGATCTGCACCTCGTGCCGAAT
TCG
page-top