Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25377  (registered. 2003)
Contig Information
Length 1248 bp
Clones 199 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 17
Wh_KMV Shoot grown with continuous light after cold treatment 16
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 8
Wh_PCDAM Anther at meiosis 14
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 39
Wh_V483 Shoot grown under cold condition for 3days 27
Wh_VABA Shoot with ABA treatment 10
Wh_VHS Shoot with heat shock treatment 34
Wh_VWD Shoot grown with dessication 23
Homology (BLAST) Top Hit Precursor of CP29, core chlorophyll a/b binding (CAB) protein of photosystem II (PSII) [Hordeum vulgare subsp. vulgare] >gi|445122|prf||1908428A chlorophyll a/b-binding protein
Score 1178
Evalue 3.20524e-142
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25377
ATCAACCCATCACATCCTCCCTTCTTGCTGAGCTGAGCACGCCCCTTCTCTCTCAACTTTGGGCTCGAGGCAATGGCGGCGCTCGCTCCGACGAAGATGC
TCGGCACCCGGCTCAACTTCGCCGGCTCCTCCAGGTACGCCACAGCGGCACCAACTGCTGGCGCACAGAAGATCGTCTCCCTCTTTGATCGCTTCAAGAA
GAAGCCTGCCCCGAAGCCGAAGCCCGCCCCCGTGGCCACCTCGAGCGTAGGCATCGACGACGAGCTCGCCAAGTGGTACGGCCCTGACAGGAGGATCTAC
TTGCCCAACGGACTCCTTGACCGGTCGGAGGTGCCGGAGTACCTCAACGGAGAGGTTCCCGGAGACTACGGCTATGATCCTTTTGGTCTGGGCAAGAAGC
CAGAGGACTTCGCCAAGTACCAGGCCTTTGAGCTCATCCATGCCAGGTGGGCCATGCTCGGCGCCGCCGGATTCATCATCCCCGAGGCGCTCAACAAGTT
CGGCGCAAACTGCGGTCCCGAGGCCGTTTGGTTCAAGACTGGCGCCCTTCTCCTTGACGGCAACACCCTCAACTACTTCGGCAACAGCATCCCCATCAAC
CTGATCCTCGCCGTCGTCGCCGAGGTCGTCCTCGTCGGAGGCGCCGAGTACTACAGGATCACCAACGGACTGGAATTTGATGACAAGCTCCACCCCGGTG
GCCCATTCGACCCGCTCGGCCTCGCCACCGACCCCGACCAGGCGGCGCTGCTCAAGGTGAAGGAGATCAAGAACGGACGGCTGGCCATGTTCTCCATGCT
GGGCTTCTTCATCCAGGCCTACGTCACCGGGCGAGGGCCCCTTTGAGAACCTGTGCGCGCACCTCAGCGACCCCTTCGGCAACAACCTGCTCACCGTCAT
CTCCGGCGCCGCCGAGAGGGTGCCCAGCCTGTGAGCTGGCCGTTGATTGCCCGTCCGCCGCCGTCGGCTGTTGATGGATCAGCTGCGTGCGATGCGCGCG
ATGCAGCATCATGTGCTGTGTGAATTTTACCGGGGAAAAGTATGAGAGTACGAATGTGCCGTAGCGTGTAAATTATCAAGGGCAGAAGAAACATGATCGT
TCTGATTTCTGATGGGAGTATCGGACCACTGCTTCAGCTTGTGCTTGATTTTTTATTTTCTTGCTGGAAAGCTTGTGCTTGATAACTGGTGCGACACTGC
TACTTGAGTAATTTCTGAAATGGTTTTTATCATCGTTGAAAAAAAAAA
page-top