Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25367  (registered. 2003)
Contig Information
Length 1145 bp
Clones 187 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 27
Wh_DPA20 Seed DPA20 16
Wh_EM Dormant seed with water absorption 16
Wh_EMC Dormant seed with cold treatment after water absorption 12
Wh_EMI Dormant seed with water absorption after breaking 16
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 18
Wh_PCDAM Anther at meiosis 9
Wh_RDr Root of dessiccated seed 10
Wh_SHC Shoot grown with cold treatment 18
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_VHS Shoot with heat shock treatment 6
Wh_VSCB Liquid cultured tissue 23
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 1221
Evalue 4.63217e-132
Total Hit Count 434
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25367
TTTTTTTTTTGCAAACTTAACTTTGAAGAGAGCTTTTATCAGATAATGGCTAACTTAGATCTCAAACATTTAAGGTAACCGGATGAGGTCTCGAAATAGC
GCTTAATAAGGTAAACATCCACATTACATCTAGCAGCAACCACGAGTTCGCAAATCAACAAACATCAGGCAAAACTTAAAAACGATGGTTCCAGGAACAT
AGGTCTATATCCTTGCAGATAACTGGCTATAGCAAAACGACTCAACACCTCAGAATCAGGCCTTGGCAGCAGCCTGGGCAGCGGCATCCCGCTTCCTCTG
CTCCTCAATGATGGTGAGCTTGATACCCTTGCCCTTGGGGAGGCTCACCCACGGCTTGGTGCCCTTGCCGATGGTGAACACGTTGCCCAGACGGGTGGCG
AACTGGTGGCCCTGGGCATCCTCAACGTGGATGGTCTCGAAGGTTCCCTTATGCTTCTCCCTGTTCTTGATCACACCAACACGCCCAGTGTTGCGCCCAC
CAGTCACCATGACCACGTTGCCGACGTCAAACTTGATGAAGTCAACAATCTTGTTGGTCTCCAGGTCAAGCTTGATGGTGTCATTGGCCTTGATGAGTGG
GTCTGGGTAGCGGATGGTGCGGCCATCATAGGTGTTGAGGTATGGGATGCCCTTCTGGCCAAACTGGACAGACCTGACCTTGCAGAGCTTGAACTTAGCA
TCCTCGTCCCTGACAGAGTGAAGGCGGAAGCGACCCTTGGTGTCATACAGAAGCCTGTAGTTCTCACCAGTCTTGGGAATGGAAATGATGTCCATGAAAC
CAGCAGGGTAGGTCTTGTCAGTGCGGACCTTTCCATCAACCATAATATGACGCTGCATAAGGATAGATTGCACTTCACGGTAGGTGAGAGCATATTTCAG
TCTGTTCCTCAGGATGAGGATCAGAGGCAGGCACTCCCTGGCCTTGTGAGGACCGGATGATGGCTTGGGGGCAAAAGCTCCACCAAGCTTGTCAAGCATC
CAATGAGACGGGGCATTGAGCCTCTTCAGATGCTTCTTCAAACCCCTAGCCATGGTTGCGAGCTCGGGCTAGGTCGCCGTGCTTCTCCTCTTCGGGCACC
GCCGCCGCCTGCTCCTTCTTCCTGTGCAAACGCGCCGCCGCCGGC
page-top