Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25362  (registered. 2003)
Contig Information
Length 863 bp
Clones 169 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 41
Wh_V4816 Shoot grown under cold condition for 16days 25
Wh_V483 Shoot grown under cold condition for 3days 10
Wh_VABA Shoot with ABA treatment 32
Wh_VHS Shoot with heat shock treatment 12
Wh_VWD Shoot grown with dessication 37
Homology (BLAST) Top Hit lipid transfer protein precursor [Triticum aestivum] >gi|46252474|gb|AAS84745.1| lipid transfer protein [Triticum aestivum] >gi|55792862|gb|AAV65513.1| lipid transfer protein [Triticum aestivum]
Score 462
Evalue 3.05701e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25362
CATTTCGAGGTTGAGATATGGCGACTGGTGAGTTATTTGCTCGTCACCTGGCCAGCCTCCAAATGCATATGGCGACATGACAATACAAGAGTTGCTCTTA
GTCATTTCAAATAACGACGCGTGTTAACTGAATAGAGCTAGATTAATTTATAATACCATGAGTGCACATGGGTACAAAGTACAACAAACTCCCGCTCTCT
GCTCAAAGGGAGTGAACGAACAATCAAACGCTGATACAAAATAGATACAACAGTGGCCGGCTATGCAGAGCTGGCTCGACGTACGTACTCCTGTCTCTCA
CATGGAGATCATATCAGAGCATTTATTCATGTATATGTGTATATATATATATATATATATATGTGTGTGTGTGACCTCAACGTACTCGGCATCTATCGCT
GGAGCTATAATCGGCGATGATGGCGGCAAGTAATCGATCAGTGGATCTTAGAGCAGTCCACGGATGCGCTGATGGAGTAGGGGATGCTGACGCCGCACTT
GGAGGGGATACTTGCAGCCTTTCCGGGGTTGAGCCCACCGGCAGCACTCTTGATGCACCTGCATGCCGCTTGCTTGTCGGCGGTGCTCCGCGCTAAGCCG
GCCAATCTCCTAACTCCGGAACAGCAGGCCCCAGGCGGGCTGGCCCCGCTGCCTTTTGCGTAGGAGACGCAGGAGGCCAGGGCAGAGTTCACCTGACCGC
AGGAGATCGCCGCGTCGGAGGCTACCAGGAGCATTGCCGCCACCAGGGCGACCAGCACGAGCTTTGTTGCTGCAGTGCGAGCCATCTCGACCGAGTTAGC
TGTAGTTGTGGTGGAGGGCTCGCAGGGAGAGGGTGGGTAATTAGCTAGATTTGCTCCTCGTGC
page-top