Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25361  (registered. 2003)
Contig Information
Length 1469 bp
Clones 169 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_KMP Shoot grown under continuous light 30
Wh_KMV Shoot grown with continuous light after cold treatment 7
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 27
Wh_V4816 Shoot grown under cold condition for 16days 22
Wh_V483 Shoot grown under cold condition for 3days 18
Wh_VABA Shoot with ABA treatment 29
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 22
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 806
Evalue 8.71467e-84
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25361
TTTTTTTTTTCTACTAGTGTAAGATCCATATATCGAAAGTGCACACGGTACAAAGAAGAACAAACTCATGAGTCCTCTCAAAAGGGTGAAGGAACAACCA
AACATCAATACAACAGTGTGGCCTGCCATGCAGAGCTGGCCGGACGTAGGTACTCCTCTCGCTGTCACGCAGTGAGATAATATGAGAGCACTTATTCATA
TATATGTATATGTATGTGTATGACCTCAATCGTACTCAGCGTAGATCGCTGGAGCTATATGCAGCGATGATGAGAAGAAGTGGTCGATCAACGAATCTTA
GAACAGTCCACAGATGAGCTGATGGCGTAGGGGACGCTGACGCCGCACTTTGAAGGGATGCCGGCGGCCTTGCCAGCGTTGAGCCCACCAGCAGCGCTCT
TGATGCACTTGCACGCTGCTTGCTTGTCGGCGGTGCTCCGGGCTGCACCGGCCAGACTCCTGACGCCGCTGCAGCAGGCCGCAGGCGGGTTGGCGACATT
GCCGCGTGCATAGGAGATGCAGGGGCTCAAGGCAGAGGTCACCTGACCGCAGGATATCGCCGCATCGCAGGCTACGAGGAGCATAGCGGCCACCATGGCG
ACCAGCACGAGCTGAGTAGCTGCACCGCGAGCCATCCCTATTGAGTTTGCAGTAGTAGTGGTGTTGAGCTCAGCTGGAGATGGTGAGATGGGCTAGATTT
GCTAAGTGATTGCACTGTGATGGCTTCCTCGGCCACCTCCGTCGCACCCTTCCAGGGTCTCAAGTCGACCGCCGGCCTGCCCATCAGCCGCCGCTCCAGC
AGCGCCGGCCTCAGCAGCGTCAGCAACGGCGGAAGGATCAGGTGCATGCAGGTGTGGCCGATTGAGGGCATCAAGAAGTTCGAGACCCTGTCTTACCTGC
CACCCCTCTCCACGGAGGCCCTCCTGAAGCAGGTCGACTACTTGATCCGCTCCAAGTGGGTGCCTTGCCTCGAGTTCAGCAAGGTTGGGTTCATCTTCCG
TGAGCACAANACATCCCCTGGNTACTATGATGGNCGNTACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCACCGACGCCACACAAGTGATCAACGAG
GTGGAGGAGGTCAAGAAGGAGTACCCTGACGCGTATGTCCGCATCATCGGATTCGACAACATGCGCCAGGTGCAGTGCGTCAGCTTCATCGCCTTCAAGC
CACCGGGCTGCGAGGAGTCCGGCAAGGCCTAAACAGCTCACTCACGACAGGCCATATATAAAGTGCCATTGCAGTTTTGTCAACTCTGACATTGCTTTGG
GTTTTCCTTCTCCATTTATCTTTCTTATTTGTTCCTAAGAATATGTGTATGTCCATGTTCATGTACCAACATGGCTCGAGAAAGCATGCTCGTATGAGAA
TGCTATCGGTGGCTATGTATATGAACGGACGCATAATATTATACCAATATGTCGACTACAAAAAAAAAA
page-top