Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25357  (registered. 2003)
Contig Information
Length 1775 bp
Clones 164 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 18
Wh_DPA20 Seed DPA20 11
Wh_EM Dormant seed with water absorption 7
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 17
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 9
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 8
Wh_RDr Root of dessiccated seed 21
Wh_SHC Shoot grown with cold treatment 21
Wh_SHDr Shoot grown with dessication 8
Wh_V4816 Shoot grown under cold condition for 16days 10
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 9
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|396134|emb|CAA80666.1| protein synthesis elongation factor-1 alpha [Hordeum vulgare subsp. vulgare]
Score 2154
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25357
TTTTTTTTTTAGACGAAAAACATGATCAACTGATATAAAACGACTCCAAACATGCCAACTATATATAGTAGCAACATTAACTGACGAAGTTTCACCAACA
CAACCGAACGATACAATGACAGAGCAATAAGCAGTTCCAACACTGCTCGACACAAATAACCGAAGCTTAACAAGTTTCCAAAACAACTAGAACAACTATC
ACCACCACCAAATACCGCCACCGCCACCATAGATGCAGTAAAGAACCTGACACCATCTCATTTCTTCTTGGCCGCAGCCTTGGTCACCTTGGCACCGGTC
GGATCCTTCTTCTCCACAGCCTTGATAACACCCACGGCAACCGTCTGCCTCATGTCACGCACAGCAAAGCGGCCCAGGGGAGGGTACTGGGCAAAGGTCT
CCACCACCATGGGCTTGGTGGGGATCATCTTGACGAACCCAGCATCACCGTTCTTGAGGAACTTGGGCGCCGCCTCAATCTCCTTGCCAGACCGCCGGTC
GATCTTGGTCTGGATCTCAGCAAACTTGACAGCAATGTGGGACGTATGGCAGTCCAGCACCGGGGCATAGCCGTTGCTGATCTGGCCGGGGTGGTTCATG
ATGATGACCTGGGCGGTGAAGTTGGCAGCCTCCTTGGCAGGGTCGTCCTTGGAGTTGGAAGCGACGTACCCACGCTTGAGATCCTTGACAGCCACGTTCT
TGACGTTGAAGCCGACGTTGTCACCAGGAAGCGCCTCCAGGAGAGACTCATGGTGCATCTCAACGGACTTCACCTCAGTGGTCAGGCCAGTAGGACCAAA
GGTGACAACCATGCCTGGCTTGATGACTCCAGTCTCAACACGGCCCACTGGCACAGTTCCAATGCCGCCAATCTTGTACACGTCCTGAAGGGGAAGACGG
AGGGGCTTGTCTGAGGGCCTCTTGGGCTCATTGATCTGGTCCAGGGCCTCGAGAAGGGTGGGGCCCTTGTACCAGTCAAGGTTGGTGGACCTCTCAATCA
TGTTGTCACCCTCGAACCCAGAGATGGGAACAAAGGGAACCTTGTCAGGGTTGTAACCAACCTTCTTCAGGTATGAAGAGACTTCCTTGACAATTTCTTC
ATAACGGGCCTTCGAGTACTTGGGAGTGGTGGCATCCATCTTGTTGCAGCAGCAGATCATCTGCTTCACACCAAGAGTGAAAGCAAGGAGAGCGTGCTCA
CGGGTCTGGCCATCCTTGGAGATACCAGCCTCAAAACCACCAGTGGTGGAGTCAATGATAAGCACAGCACAATCAGCCTGGGAGGTCCCGGTGATCATGT
TCTTGATGAAATCACGGTGACCAGGAGCATCAATGACAGTGCAGGAGTACTTGGTGGTCTCGAATTTCCACAGAGCAATATCAATGGTGATACCCCTCTC
ACGCTCAGCCTTGAGCTTGTCAAGCACCCAGGCATACTTGAAAGACCTCTTGTTCATCTCAGCGGCTTCCTTCTCAAACCTCTCAATCACACGCTTGTCA
ATGCCTCCAAGCTTGTAGATGAGGTGGCCAGTCGTGGTTGACTTGCCAGAGTCGAGCATGGCCAATGACCAGCAATGCTGATGTGGATCTTCTCCTTTCC
CATGGCTGCTGGAGGCTGTTAACTACCTACAGATGCGACCCGTATACCACCTACTGGCGCGCGAACGACCTACAGATGCGACGGCGTACGAACGAGCAGA
GGTAACCACCGGCGCGGAAACGGCCGGCGGGGAGGAGTACCTGGCCTACCGGAGATCGAAGAGGACGGAGGGGCG
page-top