Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25354  (registered. 2003)
Contig Information
Length 846 bp
Clones 161 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_SHDr Shoot grown with dessication 28
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 45
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 79
Homology (BLAST) Top Hit RecName: Full=Zinc finger CCCH domain-containing protein 19; Short=OsC3H19 >gi|125584263|gb|EAZ25194.1| hypothetical protein OsJ_008677 [Oryza sativa (japonica cultivar-group)]
Score 89
Evalue 0.524638
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25354
TCTGATATCGCGAACTTGTTATCGCTCTTCCGAACCACCACAAAATATGTATTTCTATATTTATTTATTCTTGTAAAAGTAGATCTTTATTGTAAAGGTT
CACATGAAGTACAAAGCACCCCAAACATAATAAACATTACATGAAGGTAGGCTGGCCCACGAACGACCACTGTTCCACACCGGAGCCGGCCCGATCTTGT
CGATGACAACTGAGAAGTCTTTATGCACACGCCCCTAATGACATGTGCCCGCTCTGAAGCCGCAGTCATCGCCGTTGAAGCCCATGAACCCGACACCAAA
TCTCGCCGTCGCACACGCACGACAAGAATACCCTAACCTCACCGCCCCGAGGAGCTGGCAGGAATCTACGCCGGACAACCACGAAGTTGAGGAGCCCGGG
AGACCGTAACCGCAACCACAAGGACCACACATACACGGTGGTTCATAACAGAAATAGAAAGTGGAAGTACGTAGTATTTATTGTAATACGTAGTATTCTC
TTTGCTGCTGCTATACGGTAGGCTCAGTGAGCATGACTTGCAGCAAAGTGTGGCGCATGGCCATGGGCATCATGCCCCATGTTTCCTCCCGCACACGTGC
CTTTCTTGAAGTAGAGGCATGGAGCACCTGCCTTGGCCTTGCCATCGGCCGCCGATTGCTGAGGAGATTGCTCGTCCACGGCCTGCTTGTTGAGGTCGGT
GCTCCGGCGGTCATCACCGGCCCGGCGCCTGGAAATCCATCGCCTATTAGCTCTGCTCAGCTCAGCTCCTCCTCCACCTCCTACTTAGCAAATCTAGCCT
CTCACCATCTCCAGCTGAGTTCAACACGATTACTACTGCAAACTCG
page-top