Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25352  (registered. 2003)
Contig Information
Length 1653 bp
Clones 159 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 7
Wh_KMV Shoot grown with continuous light after cold treatment 7
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 42
Wh_V483 Shoot grown under cold condition for 3days 37
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 29
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 30
Homology (BLAST) Top Hit Os03g0592500 [Oryza sativa (japonica cultivar-group)] >gi|122246902|sp|Q10HD0|CB23_ORYSJ RecName: Full=Chlorophyll a-b binding protein, chloroplastic; AltName: Full=LHCII type I CAB; Short=LHCP; Flags: Precursor >gi|152013384|sp|A2XJ35|CB23_ORYSI RecName: Full=Chlorophyll a-b binding protein, chloroplastic; AltName: Full=LHCII type I CAB; Short=LHCP; Flags: Precursor >gi|50839002|gb|AAT81763.1| chlorophyll a/b binding protein [Oryza sativa (japonica cultivar-group)] >gi|108709618|gb|ABF97413.1| Chlorophyll a-b binding protein, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549057|dbj|BAF12500.1| Os03g0592500 [Oryza sativa (japonica cultivar-group)] >gi|125544706|gb|EAY90845.1| hypothetical protein OsI_12453 [Oryza sativa Indica Group] >gi|125586998|gb|EAZ27662.1| hypothetical protein OsJ_011145 [Oryza sativa (japonica cultivar-group)]
Score 1260
Evalue 2.30429e-136
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25352
TTTTTTTTTTCTCTTTCTGCGGGGAGATACTATATTCTTTGAAGCAATTATTTCTAAGATCTTTACAGACAAGACAAGAGATAGCCCACTGAATAAATTA
CTGTCACTGTTATGTCTAATAGATATACTCCATTATTCGGACATCGAAAACGGGAAATCAGGGATGTGTCCATACATGCCAGAAAGGAGACTACAGAACA
GATAATCCTGCCGAACATGTGCCACATCTTGGTGAAGAACTTATAGGACGGTGGTGGTGCCCTCCAGCCAGAAGAGCTGCATCATCTCTGAGGACTCACT
GGGGAGGAAACGAAGGCGATCTACCCTAAAAAGAAAAAACAGACAGCACGAAATCGTGAGATGCGACCGCGGGCGCGGTCAGTGCGTCTTGCTCCGCGTC
GGCTGCTTCTGGGAAGCCAGCTTGTAGATCCAGAACACGAGGGCTAGGACGTGAGCGGCCCCGAGGATGACGACGAAGAGTGGTACGGAGTCCAGGACGT
GGGCGCCGGCCCCCGGCTGCTGCTGCGGCATCTTCCGCGGCGACGGTGAGGGCAGGTTTCTGGGCTGGGTTTCTCCCTCGTGCCGATTCGGCACGAGGCA
CGATTCTTCCATCCATTCCCTCGTGCACACCTTGTGCTTAATTAATTTACATTGCCGCGCAGCTAGCGAGAGGACCTCTCGCTCGCTCGATCATGGTACA
AATAAACACACAAAGTACGTGCAGCTACACGTTGATCCACGACGTACAAGTACACATGCATATCTCGTCCGATGGACGGACGGACGGACGGACGGCTAAA
CACATTTAGCTTCCGGGGGCGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTGACCGGGTCGGCGACGTGGTCGAAGAGGTTCTCAACTGGCCCCTTCC
CGGTGACGATGGCCTGCACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGAGCTCCTTCACCTTGAGCTCGGCGGCGGTGTCGGGGTC
GTCGGCGAGGCCAAGCGGGTCGAAGGCGCCTCCTGGGTAGATGATGTCGAGGCCCTCGCCGAGGGGGCCGCCACCAACACGGTAGCCCTCGATGAAGCCC
ATGAGCACCACCTGCACCGCCCAGATGGCGAGGATGCTCTGCGCGTGCACCAGGTTGGGGTTGCCCAGGTAGTCGAGGCCGCCCTCGGAGAAGATCTGGA
CGCCGGCCTTGAACCACACGGCCTCGCCGAACTTGATGCCGTTCTTGGACAGGATCTCCGGGAACACGCACCCCAGGGCGCCGAGCATCGCCCACCGCGA
GTGGATCACCTCCAGCTCCCTGTTCTTGGCGAACGTCTCGGGGTCAGCAGACAATCCGGCGGTGTCCCACCCGTAGTCGCCGGGGAACTCGCCGGTCAGG
TACGACGGGGTCTGCTCGGAGAACGGGCCCAGGTACTTGGGACGGTCTGGGCCGTACCAGATGCTCTGGGGCGCGCTCTTGACGGTCCGGCGCATGGTGA
TGCGGCCGCCGAAGTCGCCGACGCTGCGGACGAGGTCATCGCGGCGCGGGGCGGTGCCGAGGAAGCTGGTCGTCTGGTGCAGCGCCGATCGCGGCCATTT
CGCTGGTGGCTGGGGCTGCCTGCGAGCTCAGTGAGATGAACTGGTGGATGGTG
page-top