Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25341  (registered. 2003)
Contig Information
Length 781 bp
Clones 148 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 14
Wh_KMV Shoot grown with continuous light after cold treatment 11
Wh_MS Seed DPA5 of DT3DL CS wheat 20
Wh_OKCS Seed DPA5 17
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 32
Wh_V4816 Shoot grown under cold condition for 16days 12
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 10
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 18
Homology (BLAST) Top Hit lipid transfer protein [Triticum aestivum] >gi|94315725|gb|ABF14725.1| non-specific lipid transfer protein 1 precursor [Triticum aestivum]
Score 377
Evalue 1.81947e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25341
TATGAATTCGGTTTATTTTCATCGTCTCTCACGGTTTTTATGTGGAATAAAATACGTAGGAAAATGATTATAAGCATAATCCATATATATACTGGAAGTG
TACGCGGTACAACGTACAATAAAGTCTCGGTTCTCCTCAAAGGTAGTGAAAGTAAAAACAACCATAGTAGTAGTACAATAGTTGCCGGCCATGCAGAGCT
AGCTCGGCGTACGCACTCCTTTCTCCCTCACATGGAGATCAGATCAGAGCATTTATTCATATGTATTAGAGACCTCAGCATACTCAGCGGTGATGGATGG
CGCTATGGACGGCAGCCATGGTGGGCAGTGGTTGATCAGCGAATCTTAGAGCAGTCGACGTTAGCGCTGATTGCATATGGGACGCTGACGCCGCACTTGG
AGGGGATGCCGGCGGCCTTGCCAGCGTTGAGCCCACCGGCAGCGCTCTTGATGCACTTGCACGCCGCTTGCTTGTCAGCGGTGCTCCGGGCTGCCCCGGC
CAGACTCCTGACACCGCTGCAGCAGGCAGCAGTCGGGTTGGCGCCATTGCCGCGGGCATAGGAGATGCAGGGGCTCAAGGCGGAGGTCACCTGACCGCAG
GAGATGGCCGCGTCGGTGGCTACGAGGAGCATAGTGGCCACCATGGCGACCAGCACGAGCGGAATAGCTGCACCGCGAGCCATCCCTATCGAGTTTGCAG
TAGTAATCGTGTTGAACTCAGCTGGAGATGGTGAGAGGCTAGATTTGCTAAGTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
page-top