Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25340  (registered. 2003)
Contig Information
Length 2253 bp
Clones 146 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 8
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 10
Wh_KMP Shoot grown under continuous light 13
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_MS Seed DPA5 of DT3DL CS wheat 7
Wh_OKCS Seed DPA5 19
Wh_PCDAM Anther at meiosis 8
Wh_RDr Root of dessiccated seed 11
Wh_SHC Shoot grown with cold treatment 10
Wh_SHDr Shoot grown with dessication 7
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 10
Wh_VWD Shoot grown with dessication 10
Homology (BLAST) Top Hit Os02g0776700 [Oryza sativa (japonica cultivar-group)] >gi|46805510|dbj|BAD16961.1| MYB transcription factor-like [Oryza sativa Japonica Group] >gi|46806152|dbj|BAD17382.1| MYB transcription factor-like [Oryza sativa Japonica Group] >gi|113537817|dbj|BAF10200.1| Os02g0776700 [Oryza sativa (japonica cultivar-group)] >gi|215687360|dbj|BAG91925.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1415
Evalue 3.58058e-154
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25340
CATTTTGCAGGCGCGGTAGATTATTTACATTGCACATGGAGAACGCGATTACAACTTCGTCGCGATAATATGTGTGTTCGTCGTCCACAAGCGTACTACA
CCTACTATCTCTCTCGGATGTTTTTTTCATCTACTTGCCTTGCAGCACATGGATCACAGGAACCCCGACGAACCTCTCCCCTGTGCCACCTTGCTGCTCT
GCCCTGAGAACTTGATTGCCGCCGCCAGGTTGCCGGCTTGCGGCTGAAGCTCAGCTAGCTCTTTCACTCGTAGCAAAATGGCCGGTGGTATTGGTATGAT
CGAAGGGTTGCTTTTCCGCGGACAAACACCATCGTTTTCCGGCGAAAGCTGTGTCTGGCTGGCTCTTAGCAGATTGCGCCACTTATCCTTGAGATCCACT
GAGGTGCGGTAAGAATATGAGGCAAAGGATAGTCTTCTAATCTCAGACCATTTGCCAGGCCCGAACTGAGCCACGCCATCGACCAGCTTCAGAACTTCGG
ACAATGTCCATGCTCGATGATGCTTCCGCTTCAAACCCCGCTTTGTTTTTGTTTTGGCATCAGTTCTGCAAATATCGTCTGCTTCTATGGAACGAATCTC
CTTGTTATCAGCTGTTTCTATATGCCCTCCTTTCTTCTCAGCTGTTTCTATATGCCCTCCTTTCTTCTCAGCTGTTTCTATATGCCCTCCTTTCTTCTCA
GCATTTTTCATTAGCGGAACTTCCACAGCACTGCTTACATGATTCACATGTTCACCATCTTTTCCCAACATCGTCTCAACTGCCATCTGAACCTCAGGAC
ATTCCACCGGTGGATCGTCATCCAAAAATGAAATGAAGTTTCTCCGGGGACGCCCTCTTCTCATCCTTGACGCATAAGGAACATGTACACTAAATCCTCC
AAAAGTATCCTTCCGGGTAGGATAAGTTATACTCAATGAATCAACTTCTTGTAAAGGAGTAACCCGTTGTCTGAGTAACACCTCACCATGTGCAGCCCTT
TTTCCTGGTGAAGAAAGCTTCCCAGTGGAGTCAAGTGTCTCGGTATCTGCGAGCTCCTCAATGTATCTTTTTGTTGGTTTTCGAAGTCTCTTAGCGGCGC
CTTGTTCATCCTGCAAAGTTCCTTCTGATTCATCGTTGTCTGTTGATACTCCTTTTAGCCTATTGGAGGATCGCTGTTGGTCCTCACTCCGATAGTAAGA
GCAAGATGATGTGTCTCTCTCATTTCCAGAACCCAATACTTGAAACCTAACCAAAGAAGTAGCTTCAACCTCAACCTTAGGTAATCCTTCAATTGTAGGT
AGCTTGTGTTTGGCATCCTTGCAAACTATTTTATAATCTTTAACTACACAGCCTGAACTTTGAACATCGCAGGAATTGGTCAGTCCCATTGTAATCCGTC
TTTTGAGCCATAGCTTGTCCTTGACAGTAGTTTCGCGCCCAAATGTGGCTCTAAATGCTTCCTGGAGTTCTCTAATTGTAAGATTATCCAAACAGACTTC
CCCTCTTAAAATGGAGAAGTCGGGAACTGGCATCGCCTCGCGCCCGCACCCCAGGAAGGTAAGTTCAAGAGGCTTTTCTGAGAAGCTCAAATGGCTCCCA
AAGTTGCTGTTGCCAAGAAGGGCGATGCCAAGGCCCAGGCCGCCAAGGTTGCCAAGGCTGTGAAGTCTGGGTCAATCAAGAAGACGGCAAAGAAGATCCG
CACTTCTGTGACATTTCACCGCCCCAAGACCCTGTCCAAGGCCAGGGACCCCAAGTACCCCAGGATCAGCACCCCTGGAAGGAACAAATTAGACCAGTAC
CAGATCCTCAAGTACCCGCTTACCACTGAGTCTGCGATGAAGAAGATTGAAGACAACAACACCCTTGTCTTCATTGTCGACCTCAAGGCCGACAAGAAGA
AAATAAAGGCTGCTGTCAAGAAAATGTATGACATTCAGGCCAAGAAGGTTAACACCCTCATCAGGCCTGATGGCAAGAAGAAGGCGTACGTGAAGCTGAC
ACCAGACTACGATGCTCTTGACGTGGCCAACAAGATCGGCATCATATAAGCCAGAGGGAGGGTCCTGCAGTAGGCGCTTGTGTCGTGGTTTCTTATGTTA
TTGGAATTTTGTAGTTGTTACTTAGCAAAGGGCCTTAGTGGCTCCATTGCCTACCATATCGCTGCACACTTTCATGAATTTGATGCAATCGAAGTGACTT
GTGTTGATGCTAATTTGAGCTTTGCGTTTGGTCTTACCAAAACAAAAAAAAAA
page-top