Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25338  (registered. 2003)
Contig Information
Length 1594 bp
Clones 144 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 14
Wh_EMC Dormant seed with cold treatment after water absorption 16
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 9
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMV Shoot grown with continuous light after cold treatment 7
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 11
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 12
Wh_SHC Shoot grown with cold treatment 18
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 6
Wh_VSCB Liquid cultured tissue 8
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit hypothetical protein OsI_08713 [Oryza sativa Indica Group]
Score 990
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25338
ACTAAAAATGCAAACAGAAATAGGATGTCAAGACCAACAGCATAAACTTGGACCATAATAATCTCAGTAGGATTGGAGGACAATGTATTTAAGGAAAATT
GCCCAGTAACGATTCAGGGCACATACTCGAACTCAAACTCAACCCCTATGATAGTAAATGTTTTGAGAACGCTGCCGCCAACCTACGACAACCTCTGGAG
TTCGATGCCTCCACCAAAAACGAATGTTGGGAAAATCCACCCTCTACAGAAATTATTGCCTTCCAACGTTAAAAAGATAAAAGTTCGCCAGATCCTTGAA
GGGCAGGACTGGGAACAGACTTCTCTTGTTCGTCATCATTTCTTCCCCTCTAGGCACCGCCTGAGCCGTACTTCTTGCCGAAGAAGAGGATCTGGAGCTG
ATCGTAGCCGGAGAGCACACCAGCACCAGCAATGGCACGGAGGATGTTGGCACCAGCACCCTTGAAGAGAGACTTGGCACCCTCCTTCGCCAGGATCTGC
TGGAAAGCATCCAAGGAGCTCTTGTACTTGACAGCCTCTCCGGAGGTCATCATCATCCTTCTGCGGACGGTGTCAATGGGGTAAGATGCAAGACCGGCAC
CGTTGGTGATCAACCAACCAAGAGCAAAGCTGGCAAAGAAGTTGTCCTGGAGAGTGCCAGTGAGGAGAACGGGCTTCAGAGAATCATACAGTCCAAAGTA
CAGACCACGGTAGACAATGATTCCAACACAAGAGATGTTGAATCCACGGTAAAGCCCAGCAATACCATCTGACTTGAGAGTCTTGCGGTAGACATCAACC
AGGCCATTGAATTGCCTGTCACCTCCACCCTTGGGATGCCTTTGCGTCATTGGCCAGCCTTGTCCTAGCATAGTCCAGGGAGTACACGAAGAAGAGCGAG
GAAGCACCAGCAGCACCACCAGAAGCAAGGTTGCCACCGAACCACTTCCAGTAACCATCCTTGTCCTTCTTGAAGTTGAACATCCTCTTGAAGTAATCCT
TGAATGCAAAGTTCAAAGCCTGAGTTGGGAAGTAACGGATGACGTTAGCAGTGTTTCCTCTCCACAATGAGCCAAAGCCTTCATCCTTGATGGTGCGGCC
AAAGCAGTCACCAATACCCTTGTATGGCTCAGAGAGCCTGCCAGCCTTGATCATCTCATCCTGGTTCTGGATAAGCAGCTTAACACGCTCAATAGGAGCT
GCAGCAGTCTTGGAAACTGCAGCGGACACTCCTCCCATGAGGAAGTCAATTGCAAAGTTCTTGACACCTTTCTTCTCAGGTGGTGCATTGGCAAACAATG
GAGAAGATGACATCATGGGGACACTGATGCCAAGGTTCTGAGTCATGTAGCAGCTTGTGGTGAAGCGCCTCTCATAGGATGGCACAGAAGGGCAGATGTT
GCGAGCACGAACACCCTCAGAGAAGCTGGAGGCAAGGTGGAACTGTCCACCAAACTTCTGCATGACAGACGGGTGGTTAGCACGGTCCGCCATCTCTGAC
CCTTCGGAAGCGGAGGCGAGGAAGATGGGGTGGTGGCTCTTCCCGGCTCGGCGGCTCCGCTCCTTCCGGTCTTGCGGTGAGAGAGAGAGAGGGG
page-top