Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25332  (registered. 2003)
Contig Information
Length 708 bp
Clones 139 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 13
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 13
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 8
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 10
Wh_PCDAM Anther at meiosis 20
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 15
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 11
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein [Zea mays] >gi|195618726|gb|ACG31193.1| hypothetical protein [Zea mays]
Score 379
Evalue 8.8605e-35
Total Hit Count 89
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25332
TTTTTTTTTTGTAAAAAAGATGAATTTTGCGACAGCATACTGACTAAGCACGAGGAGCAAATCCACAGAGGATTAAGATAATGTAGCACAACAGGCTGAT
AGAGGACGATTACATAGTAGATGGGCACACAACCAAAGCAGCCGGGACAGCAGCACACCGAGTTCAGACCCCAAGCTTAGGTCAACAATCAGTCATTGCG
GAACATGATAATAGTAGGTGGATTATGACAGCTTCTCTCTCTCTCTCTCTTTTATCTCTCTCTCTGTCTGATTGGGCAGATATCACTGCTTGAGGTGAGG
GAAGCACTGGACGAGCTCGCTCTTCGGATGCTTTGCCTCGGCATGCTCCTTGCACTTTGCTTCAGAGGTGGTGCAGATGAAAGTCTGCATGCATATCTTG
CACTGGATGTTCATGGCCTTCTTGTTGGCCTCGAGCTGGCTCCCCTTGCCGCCCTTCAGCTTCTCGAGGTTCCTCTCCCTCGCCATCTTGGACTTCTGCG
CGTTGCCGCCGCCCATGGCTGTTGATTCCTCGACGAGACGAGACGAGACGATGCTTTTTCTGCTTCGGCGGAAATTTGGTGGGGAAGGCGAGAAGCAGGA
GGCGGCTGCGTTTAATAGACGTGGAGGTGGGAGGTGGAGGCGGAAGCCGACGTTGGCGTCAATCAATCGCGGGCAACTTGCGCGTGCCAGTGTCCGTGCG
GCACGAGG
page-top