Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25327  (registered. 2003)
Contig Information
Length 779 bp
Clones 133 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 9
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 10
Wh_EMI Dormant seed with water absorption after breaking 13
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 15
Wh_OKCS Seed DPA5 18
Wh_PCDAM Anther at meiosis 10
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 8
Wh_SHDr Shoot grown with dessication 8
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 8
Wh_VWD Shoot grown with dessication 3
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 198
Evalue 1.03796e-13
Total Hit Count 55
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25327
TTTTTTTTTTCACCACAGCGCAAGTTTCCACCAAAATATGTACGAGTCACAACCCACAGGGCCACATGTCAATGAGTCCATCCAAACATAGAGATGGGCA
TGCTGAAAATCAGAAAACCAAAACCAGGTTTGACACAGCAAGGTAGAAGGCAAACAATGAATTAGACACACCAACTTTTGAGATGAAGACGATTAGTTTG
AAAGCGACAGGTTTTAGGCAAGCTGGCTTCCAAGCAGGAGGTCAGCCTGGACACAATGAACCATACAGACAGAGTACATCGACGCAGGTGGTAAACTGCT
GAAACCAAACACTTCCAGTTTTCACCACATGGATAACAGAGATACAGGCCAATTCATCGCAGCATCATTAACAGAGATCACTTCCCGCCAAACAAGTAGC
CCAGGGACGAGCCACCGCCGGGAGCAGCATGAACCTTGGTTGAAGGACGGTCCGTAAGGAAGTTGCCCGTGTTCTGGCCATCTGCACGGTAGTAGTTGTT
CGCCCGGCTACCTGGAATGCCAGCTGGAATCTGCTTGGTTACATCGGCAGCTGCCAGTGCTGGTTTCTCAGCAGGTGCTGGCTTCGCAGCTGGTGCTGCA
GCAGGCTTTGCAGGCTCACCATCTCCAAACAGGTAACCCAGAGAACTTTGACCACCTCCAGCACTCCCGCCACGACTCATCTTGACTTAGATCGGGCGCC
GATCGAGGGGACGGGGGACGGGGGACGAGGACGAGACAGGAGGAGGCGCTCGAAGTGCCTCGTGCCGAATTCNGCACGA
page-top