Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25319  (registered. 2003)
Contig Information
Length 1465 bp
Clones 125 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 7
Wh_DPA20 Seed DPA20 6
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 18
Wh_OKCS Seed DPA5 12
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 13
Wh_SHC Shoot grown with cold treatment 7
Wh_SHDr Shoot grown with dessication 8
Wh_V4816 Shoot grown under cold condition for 16days 7
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 8
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit RecName: Full=14-3-3-like protein A; Short=14-3-3A
Score 1013
Evalue 1.8528e-136
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25319
TCGCCCTCCTATTTTTCTATCCCCCATCCCGCACCCCTCCTCTCCCCCACTCCTCCCTATTCCTATCCCCCCAGCCTCCCCCCACGAACCCACAGCGCGC
ACCCGAGATCCGCAGCCGAAGCCCGCTGAAGAGCAGCGAAGCGCGAGAGGAAAGGCACTGAACTAGTTTGCAACAAAGAAGAGGGAAAATGTCTACCGCT
GAGGCAACCCGTGAGGAGAATGTGTACATGGCCAAGCTCGCCGAGCAGGCTGAGCGTTACGAGGAAATGGTTGAGTTCATGGAGAAGGTCGCAAAGACCG
CTGATGTTGGTGAGCTCACTGTTGAGGAGCGCAACCTGCTCTCTGTGGCTTACAAGAATGTGATTGGTGCCCCGGAGGGCTTCCTGGAGGATCATCTCCT
CCATTGAGCAGAAGGAGGAGAGCCGTGGGAACGAGGCCTATGTTGCTTCAATCAAGGAGTACCGTACCAGGATTGAAACCGAGCTCAGCAAGATCTGTGA
TGGCATCCTCAAGCTTCTGGACTCCCACCTTGTCCCCTCTGCCACTGCAGCAGAGTCCAAGGTGTTCTATCTGAAAATGAAGGGTGACTACCACAGGTAC
CTTGCGGAGTTCAAGGCGGGTGCTGAGAGGAAAGAAGCAGCTGAGAACACTCTTGTAGCATACAAGTCGGCCCAGGACATCGCGCTTGCTGACTTGCCTA
CCACCCACCCGATAAGGCTTGGACTTGCACTCAACTTCTCAGTGTTCTACTATGAGATCCTGAACTCTCCAGACCGTGCTTGCAACCTTGCCAAGCAGGC
ATTTGATGAAGCCATTGCTGAGCTGGACTCCCTCGGCGAGGAATCCTACAAGGACAGCACCTTGATCATGCAACTTCTTCGTGACAACTTGACTCTCTGG
ACCTCCGATAACGCAGAGGAGGGTGGTGATGAGATCAAGGAAGCCGCCTCAAAGCCTGAGGGAGAGGGGCACTGATTGGCTGGCCCTCGAGCGTGCCCAA
GTTTATTTCCGAGTCCATTTACGCAGCTACCTGTATCATTCGGATCATAAGATGTACTAGGGTCGGTTGCACTATGTGAATCATAAGATGTGGTAGGATG
GTGCTATGCGAAGCGTGTCGAGCTGAAGTACCTAGTGGACTACAGTCATGAGGACGGTCATGTGGACATCGTCGCTTCTTAGTTCATTAGCAGATTTCAA
ACTATTTCCTGTATTGCAGCACATTATTAGTATTGCTGTATTAGCAATTTTCATGGCTTGTTGATGATTGATCATACTTGGCGTCAAGCACCCCCAAAGC
TTGCCTTTCTAATGAGGCAACAGCTGAGTTTTTCTTGTCTACTTCCCTCTCAAAATAATTGAGTTCTAGGATTCTTCTAAGTCAATAAGTTTGATAAATT
TGATATGAAATTATATCAGCATCTATAAAATCGATTTTATTCCCTTAGTTAAATTAAAAAAAAAA
page-top