Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25315  (registered. 2003)
Contig Information
Length 1785 bp
Clones 119 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_DPA20 Seed DPA20 4
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 14
Wh_KMV Shoot grown with continuous light after cold treatment 13
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 6
Wh_SHC Shoot grown with cold treatment 9
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 16
Wh_V483 Shoot grown under cold condition for 3days 12
Wh_VABA Shoot with ABA treatment 4
Wh_VWD Shoot grown with dessication 11
Homology (BLAST) Top Hit putative S-adenosylhomocystein hydrolase 2 [Hordeum vulgare subsp. vulgare]
Score 2311
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25315
TACGGCAATAGTCATTAAGAAACCACACAAAATATGAGCATCAGATTCCGAAGGATTTCAGACACAGTAGAACAACCGAGATAAAACAGCATATGGAAAA
GAACACCACCTCACTTAAACCAATAATAATGCCATTATTTCTGGGCAAAAGCAAACGCCGCCTCTCCCAACCCTCACAAGGGCTCAAAACATAACCATAA
TAACAAATCCTCCGCCTAAGAGACAGCATGTAAGATAATAGAAGGGAAACAGGATAGTTGATAAGAGTTCCCGTTGGTGCCGCTGCTCCGACTCAGGCTC
AGGCCAGCCGCTAGTCGTGCTGGACACACTAGTACCGGTAGGCCGCAGGCTTGTACGGACCCTCAACTGGGATGCTAATGTAGTCAGACTGGGACTTGGT
GAGCTTGGTCAGCCTGGCGCCGAGCTTGCCCAAGTGGAGGGCCGCGACCTTCTCGTCGAGGTGCTTGGGGAGAACGTACACCTTCTTCTCGTACTTGCCA
GTGGCCTTCTCGTTCCACAACTCAAGCTGAGCAATAACCTGGTTGGTGAATGAGCAGGACATGACGAAGCTGGGGTGGCCAGTGGCACATCCAAGGTTCA
TCAGACGACCCTCAGCAAGAACAATGATGCCAGTCTTGGTCTCGGGGAAGACCCAGCGGTCAGTCTGGGGCTTGATGGTGATGCGCTTGACACCAGGGTA
GGTCTCAAGGCCGTTCATATCGATCTCATTGTCGAAGTGACCAATGTTGCAGACAATGGCGTTGTTCTTCATCTTCCTCATGTGGTCAACCATGATGATG
TCCTTGTTTCCGGTGGTGGTCACAAAGATATCAGCCTCAGAGACAACATCCTCCAAGGTGAGGATCTGGATGCCCTCCATCAGGGCCTGAAGGGCACAGA
TGGGGTCAATCTCTGTCACGATCACACGGGCACCAGCCTGCTTGAGTGCGGCCGCACAGCCCTTGCCAACATCACCATAACCGCAGACCACGGCAACCTT
GCCGGCGATCATAACATCAGTGGCCCTCATAAGACCATCAGGGAGCGAGTGACGGCAACCGTAAAGGTTGTCAAACTTGCTCTTGGTGACGGAGTCGTTG
ACGTTGATGGCGGGGAAGAGGAGGGTGCCGGACTCCTGCATCTGGTAGAGCCTCTTGACGCCGGTGGTGGTCTCCTCGGACACGCCGACGAGCCTCTCCT
TCATCTTGCGGTACTTGTGGGCGTCGGTCTTGAGCCCGTCGCGGATGATGGTGAGGACGATCTTGAACTCGGGGTTGTCGGTGGACTCCGGGTCGGGGAC
CTTGCCGGACTTCTCGAACTCCTCCTCGGCCTTGACGCCCTCGTGGATGAGCAGCGTGGCGTCGCCGCCGTCGTCGACGATGAGGTCGGGGCCGCCGCCG
GCGCCCCAGTCGAGGCAGCGCTCGGTGCACCACCAGTACTCCTCGAGGGTCTCGCCCTTCCAGGCGAAGACGGCGGCGGAGTCGCGGGCGATGGCGGCGG
CGGCGTGGTCCTGGGTGGAGAAGATGTTGCAGGAGCACCAGCGGACCTCGGCGCCGAGGGCGGTGAGGGTCTCGATGAGCACGGCGGTCTGGATGGTCAT
GTGGAGGGAGCCGGAGATCCGGGCGCCCTTGAAGGGCTGCGAGGGACCGAACTCGGTGCGGCAGGCCATGAGGCCGGGCATCTCGACCTCGGCGAGGTCG
AGCTCGAGGCGCCCGAAGTCGGTCCTGGGAGAGGTCCTTGACCTTGTACTCCCGGCCCGACGAGGTCTTCTCCACGGAGAGCGCC
page-top