Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25306  (registered. 2003)
Contig Information
Length 984 bp
Clones 112 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_DPA20 Seed DPA20 8
Wh_EM Dormant seed with water absorption 11
Wh_EMC Dormant seed with cold treatment after water absorption 9
Wh_EMI Dormant seed with water absorption after breaking 10
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 9
Wh_OKCS Seed DPA5 5
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 5
Wh_SHC Shoot grown with cold treatment 14
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VSCB Liquid cultured tissue 10
Wh_VWD Shoot grown with dessication 3
Homology (BLAST) Top Hit ribosomal subunit 8E protein [Brachypodium sylvaticum]
Score 823
Evalue 5.2072e-86
Total Hit Count 425
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25306
TTTTTTTTTTGAGACGCGAGAACAAAATTTCACTTAACAGATGAAAATACTGCAAGGTAGAACAACACATAATAGAATCTGGATAGCTTTAGATCACAAC
CAAAACAGGCAAAACATTCTCAGTTCAACCTAGGACTCGAACAGTTTACAGAAAATGGTGTTCAGTATGTCTGCAAACATGACATGGACGCAACATCTAA
GAAAATCCAACGAGTAACATGCAGCAGCTCTTCGGCCTAAGCTGTGGCACCCTTGCCCTTCTTCTTCTGGAGCTTCCTCATGTAGAACTCCAGCTCCTTG
CCCTCCAGGATGTACCCATCAGCTCTGCCACACTGTCCAGGGCGAGACGAAATGCAGGCCAGCAGCCTTCCACCACTGAACTGCTCCTCAATGTGCGAGT
CCAGTGTACGTCCCTGCTGGCGCTTCTCAAGCTTCCTCTGGACATTGTTGCTCTTCTTTGCTTCCTCTGTGGCAGCAGCAGCAACCTCAGCCTCTTGTCC
CTCAGCAGCTTCCTTCTTGGCAGCTGCAGCAGCTTTCTTCTTCCTACCGATTTCAACTCCATAATGAGTCAGGTACCACTGTTTGAAAGGGGCTGCATCA
ACTTGCACAATGGCATTCTTGACAAGGGTCTGAGTCCTCACAAGCTCATTGTTCGACGAATTGTAAACCACATCCAGGAGACGGGTCTTGCGGGTCACAG
CCTCACTACCCCATGAGAAGTTACCAGTGTCAAGACGGAGAGCCCTCCACTTCACGTTACCTCCGCGAACACGGACCCTCCTCACTGTCTTGTTGCTCGA
AAGCTTAGTGTTGGCTGGCTGGCGGCCGAGCTCATACTTTCGCTTCTTCCTCCAAGCCTTCTGCTTCCCACCGGTGGCCCGGCGCTTGTGCATGGAGTCA
CGCGAGATACCCATGGTGGCGTCGGTTGCTTGGCTCCGCTGCTGATTCGCCTGCGCGCCGCCGCAGCTTTGCCTCGTGCCGAAT
page-top