Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25284  (registered. 2003)
Contig Information
Length 1275 bp
Clones 103 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 14
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 20
Wh_OKCS Seed DPA5 14
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 9
Wh_SHC Shoot grown with cold treatment 7
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VSCB Liquid cultured tissue 5
Wh_VWD Shoot grown with dessication 3
Homology (BLAST) Top Hit 14-3-3 protein homologue [Hordeum vulgare subsp. vulgare]
Score 1308
Evalue 4.40994e-142
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25284
TAGACAAGAAAAACTCAGTTGTTGCTTCATAAGAAAGGCAAGCTTTGGGGGTGCTTGACGCCAAGTATGATCAATCATCAACAAGCCATGAAAATTGCTA
ATACAGCAATACTAATAATGTGCTGCAATACAGGAAATAGTTTGAAATCTGCTAATGAACTAAGAAGCGACGATGTCCACATGACCGTCCTCATGACTGT
AGTCCACTAGGTACTTCAGCTCGACACGCTTCGCATAGCACCATCCTACCACATCTTATGATTCACATAGTGCAACCGACCCTAGTACATCTTATGATCC
GAATGATACAGGTAGCTGCGTAAATGGACTCAGAAATAAACTTGGGCACGCTCGAGGGCCAATCAGTGCCCCTCTCCCTCAGGCTTTGAGGCGGCTTCCT
TGATCTCATCACCACCCTCCTCTGCGTTATCGGAGGTCCAGAGAGTCAAGTTGTCACGAAGAAGTTGCATGATCAAGGTGCTGTCCTTGTAGGATTCCTC
GCCGAGGGAGTCCAGCTCAGCAATAGCTTCATCAAATGCCTGCTTGGCAAGGTTGCAAGCACGGTCTGGAGAGTTCAGGATCTCATAGTAGAACACTGAG
AAGTTGAGTGCAAGTCCAAGCCTTATCGGGTGGGTGGTAGGCAAGTCAGCAAGCGCGATGTCCTGGGCTGACTTGTATGCTACAAGAGTGTTCTCAGCTG
CTTCTTTCCTCTCAGCGCCTGCCTTGAACTCCGCAAGGTACCTGTGGTAGTCACCCTTCATTTTCAGATAGAACACCTTGGACTCTGCTGCAGTGGCAGA
GGGGACAAGGTGGGAGTCCAGAAGCTTGAGGATGCCATCACAGATCTTGCTGAGCTCAGTTTCAATCCTGGTACGGTACTCCTTGATTGAAGCAACATAG
GCCTCGTTCCCACGGCTCTCCTCCTTCTGCTCAATGGAGGAGATGATCCTCCAGGAAGCCCTCCGGGCACCAATCACATTCTTGTAAGCAACAGAGAGCA
GGTTGCGCTCCTCAACAGTGAGCTCACCAACATCAGCGGTCTTTGCCACCTTCTCCATGAACTCAACCATTTCTTCGTAACGCTCAGCCTGCTCGGCAAG
CTTGGCCATGTACACATTCTCCTCACGGGTTGCCTCAGCGGTAGACATTTTCCCTCTTCTTTGTTGCAAACTAGTTCAGTGCCTTTCCTCTCGCGCTTCG
CTTTTCTCACGGGCTTCGGCTGCGGATCTCGGGAGCGCGCTGTGGGTTCGTGGGGGGCGGGGGGGGATAGGAATA
page-top