Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25275  (registered. 2003)
Contig Information
Length 1100 bp
Clones 99 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 8
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 10
Wh_KMP Shoot grown under continuous light 12
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 10
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 5
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 7
Wh_VHS Shoot with heat shock treatment 10
Wh_VSCB Liquid cultured tissue 5
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit triosephosphat-isomerase [Triticum aestivum]
Score 991
Evalue 5.29075e-129
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25275
TTTTTGTGGAGAGAAAAGCAGACATGATTAAACAGCAACAAGAGCTAAAGATTATTGCTGATATATGTTCAGTAGCAAACATTATCATTATTGGCTTGCA
AGCTCAAGCTCAGGGGGAGGAAACACAGTAGCAGCTGCTCCACCACAAAATTACTAGCATAGTACACATAATAAACACAGGAGAGAAAAAAAGGAGTCTC
TTCATCTTCGCTGTCTTACTCCACGCCGAAAGGAGCCACGTCGAGATCTTGCTTAGGCAGACTTCACGGTGGCGGCGTTGATGATGTCGATGAACTCAGG
CTTCAAGGAAGCTCCACCAACGAGGAAACCATCGACGTCGGGCTGCGCGGCCAACTCCTTGCAGCTTGCGCCAGTTACAGATCCTCCATAGATGATCCGC
GTGGATTCAGCAACCTCGGGGCTCACATTGGTCTTGAGCCAGTCCCTCAGATTGGCATGGACTTCCTGTGCCTGAGCCGGTGATGCAACTTTACCGGTGC
CAATGGCCCACACTGGTTCATAGGCGACGACCACGTTGGTCCAGTCCTTGATCTTGTCAGCAATTGCTTTTGTCTGTTCAGCGACAACCGCCATGGTTGA
TCCAGCTTCTCGCTGCTCAAGAGTCTCACCAACACATGCAATGACCTTCAAGCCCTGAGCGAGTGCATATGCAACCTTCTCTCCAACAAACTCGCTTGAT
TCTCCCATCAAGCTCCTCCTTTCAGAGTGTCCAAGGATGACCCAGGGAACGCCGAGGTTGACAAGCATCTCAGCACTGACTTCACCGGTGAAAGCACCGC
CCTTCTTCACCCAGCAGTTCTGAGCAGCAACTTGGATCTCTGGGGCGCAGCTTACCCTTGACGGTGGGAAGGAAGACATAGGGCGGGCTAACGACAACCT
CGACAACATCCGTAGAGGCGATCTGTCCAGCGTTCAGAGTATTGACGATGCTCTCTACCTGTTCGACAGTTCCATTGCATTTCCAGTTGCCGCCGACGAA
GAAGCTTGCGGCCCATGGCGACGGAGGAGGAGGGGGGAGATCGGATCGGGTTGGGACGGGCGGACGGGAGAGGGGGGCTCGAGATTGGATTTGGTGGCGT
page-top