Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25262  (registered. 2003)
Contig Information
Length 1005 bp
Clones 96 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 10
Wh_DPA20 Seed DPA20 11
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 11
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 10
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit small Ras-related GTP-binding protein [Triticum aestivum] >gi|19919694|gb|AAM08320.1|AF488730_1 small Ran-related GTP-binding protein [Triticum aestivum]
Score 825
Evalue 1.88786e-107
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25262
TTTTTTTTTTAGCAAGCACACAGATGCTCAAGATAAATATATGATCCACACATTGAGCCAACAGGCATAATAATACTGATGAACCATCAAGGTGGCGAAC
AACAAATCCATGGCAAGCAACATGATGTAGATCAATGTCACACAAACAGTTTGCAGCCCACCAGACAAGGGCAAGGCAGACAGGAAAAACATCCGGCTTG
ACTACTCCATATCAAGCCTTCAACCTAAAACCGACTCGCATAGTCTCTGGCTCTCAAAGTATTGATTGATAAGACAGACTCATGATCCTCTCTCTACTCG
ATCAGATCGTCATCGTCATCAGGCAGTGGCTGTGCCGCTGCAGCCGCAAGCTCAGCCTCGTGCTGTTGCTGCATGGCCAAGTCGAAGGTCACTTCCGGAG
GCTTAAGGGCCACTGCTTCGACGAAGTGGATGTTGGGATCACCAGCCAGCTTCCTAGCAAGGTAAAGGAAGGGCTTCTCAAAGTTGTAGTTGCTCTTGGC
AGAGATTTCATAGTACTGGAGGTTCTTCTTCCTGTGGAATGTCACCTGCTTGGCCTTAACCTGCCTGTTCTTCACATCAACCTTGTTGCCACACAGCACA
ATGGGGATGTTCTCACAAACCCTGCACAAGTCCCTGTGCCACGTAGGAACATTCTTGTAGGTCAGCCTTGAAGTGACATCAAACATGATAATCGCACACT
GACCATGGATATAGTATCCATCCCTAAGGCCACCAAACTTCTCTTGCCCAGCAGTGTCCCAGCAGTAGAAACGGATCTTTCCACAGTTAGTGGTGAAATC
CAACGGGTGAACTTCAACACCAATGGTGGGGTTCGTATTTCTTCTCAAACTCTCCAGTGAGATGCCTCTTCACAAATGTGGTTTTGCCAGTCCCGCCATC
GCCGACGATGACGAGCTTGAAGCTGGGGTAATCGACGGTGTTCTGGTTCGGCAGCGCCCATGGTGGACGCGGGCGGCGACGGCGGCGGTGGGGGAGGGAG
GCAGC
page-top