Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25260  (registered. 2003)
Contig Information
Length 880 bp
Clones 96 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 10
Wh_KMV Shoot grown with continuous light after cold treatment 17
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 11
Wh_VABA Shoot with ABA treatment 16
Wh_VHS Shoot with heat shock treatment 38
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3, chloroplastic; Short=RuBisCO small subunit PWS4.3; Flags: Precursor >gi|170769|gb|AAA34301.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 795
Evalue 7.60004e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25260
TTTTTTTTTTAAAGAAAACTTTTCCTTTTTTTGCGGGAAAAAAGAATTAATAACAGCAAGACAATGGTCCGCGTGTTGTATATAACAAATATTACACAGG
TTTTGCATATGGATAGCCGGTGTATATAGACCTATGAGGAATTATGTATGCATGCTCGAGAACATAGGTTCCTACATACATACACAAATCATATAGAACA
AAAGGTATGCTCCGGTCGGAAAGCAGAGTCGTGCAACAGAGGTCGTGGACAAAAGTGAAATTCACAAAAGATCTTCATATGAGATAGGCCATTGTTTCAA
CTCATAGTTTAGGCCTTGCCGGACTCCTCGCAACCCGGTGGCCTGAAGGCGATGAAGCTGACGCACTGCACCTGGCGCAGGTTGTCGAAGCCGATGACGC
GGACATAGGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCGTTGAGCACCTGTGTGGCGTCGGTGCACCCGAACATAGGCAGCTTCCACATTGTCCA
GTATCGACCGTCGTAGTACCCGGGGGAGCTGTTGTGCTCACGGAAGACGAAGCCAACCTTGCTGAACTCGAGGCAGGGCACCCACTTGGAGCGGATCAGG
TAGTCGACCTGCTTCAGGAGGGCTTCCGTGGAGAGGGGTGGCAAGTAAGACAGGGTCTCGAACTTCTTGATGCCCTCAATTGGCCACACCTGCATGCACC
TGATCCTTCCGCCGTTGCTGACGCTGCCGAGGCTGCCGCTGGAGCGGCGGCTGACGGGCAGGCCGGCTGTGGACTTGAGCCCCTGGAAGGGTGCGACGGT
GGTAGCCGACGAAGCCATCACGGCGGGGGCCCATGGTATTTGTATTATCGGAGGAGAGGAGGATGCCCTCGTGCCGAATT
page-top