Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25247  (registered. 2003)
Contig Information
Length 2410 bp
Clones 91 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 11
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 41
Wh_VWD Shoot grown with dessication 23
Homology (BLAST) Top Hit glycine cleavage system, P protein [Chlamydomonas reinhardtii] >gi|158277795|gb|EDP03562.1| glycine cleavage system, P protein [Chlamydomonas reinhardtii]
Score 902
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25247
GCGCACGGTTCGGCGTGCCCATGGGGTACGGCGGCCCGCACGCTGCGTTCCTCGCCACCTCCCAGGAGTACAAGCGGCTGATGCCCGGCCGCATCATCGG
AGTGAGCGTCGACTCCAGCGGCAAGCCCGCGCTCCGCATGGCGATGCAGACCAGGGAGCAGCACATCCGGCGAGACAAGGCCACCAGCAACATCTGCACC
GCGCAGGCGTTGCTCGCCAACATGGCAGCGATGTATGCTGTCTACCATGGGCCTGCTGGCCTGAAGGCGATCGCCGACCGTGTCCATGGCCTGGCTGGTA
CTTTCGCCCATGGTTTGAAGAAGCTCGGGACAGTGACGGTGCAAGAGCTGCCCTACTTCGACACGGTCAAGATCACTTGCGCTGATGCTAATGCGATTGC
CGAGGAGGCCCGCAAAAACGAGATGAACCTTCGCGTTGTCGACGCGAACACGATCACCGTTGCCTTCGATGAGACCACCACCTTGGAGGATGTTGACAAG
CTGTTCAAGGTTTTCTCTGGTGGCAAGCCAGTGGACTTCACAGCTGAATCCATCGCACCTGAGGTCTCAAGCTCAATTCCTCCTAGCCTTGTGCGCGACA
GCCCCTACTTGACTCACCCAATCTTTAGCATGTACCACACTGGAGCACGAGCTCCTCCGTTACCTGCATAAGTTGCAATCCAAGGATCTCTCACTGTGCC
ACAGTATGATCCCTCTTGGTTCTTGCACCATGAAACTAAATGCTACCGTCGAGATGATGCCTGTCACCGATCCCAAGTTCGCCAACATGCACCCATTTGC
CCCTATTGATCAAGCTGCTGGCTATCATGAAATGTTTGACAACCTGGGCGATCTGTTGAACACCATCACTGGTTTTGATTCGTTCTCTTTGCAACCGAAT
GCTGGTGCTTCAGGAGAGTATGCTGGACTGATGGTTATTCGGGCCTACCACAAGGCAAGAGGAGACCACCACCGAAATGTCTGCATCATTCCTGTCTCTG
CGCACGGTACAAACCCTGCAAGTGCTGCTATGTGTGGAATGAAGATTGTTGCCGTTGGAACTGATGCCAAAGGTAACATTAACATTGAGGAGTTGAGGAA
AGCTGCTGAAGCAAACAAGGACAACCTGCTCTGCTCTGATGGTTACCTATCCTTCAACCCATGGAGTCTATGAAGAAGGCATTGATGAGATATGCAGGAT
TATTCATGAGAACGGCGGTCAGGTCTATATGGATGGAGCTAACATGAACGCTCAGGTTGGGTTGACAAGCCCTGGTTTTATTGGAGCAGATGTTTGCCAT
CTTAACCTTCACAAGACATTTTGCATTCCACATGGTGGGAGGTGGTCCTGGCATGGGTCCTATTGGTGTTAAGAAGCACTTGGCGCCATTTTTGCCATCT
CATCCAGTGATCCCCACTGGTGGCTTCCCTCTCCCTGAGAAAACCAACCCTCTTGGTTCCATTTCTGCTGCTCCATGGGGATCTGCTTTGATTCTTCCAA
TTTCGTACACCTACATAGCCATGATGGGCTCTCAGGGACTGACTGAAGCTTCAAAGATTGCTATCCTGAACGCGAACTACATGGCAAAGCGTCTGGAGAA
ACACTACCCAGTTCTTTTCCGTGGAGTCAATGGAACTGTTGCCCATGAATTCATCATTGATTTAAGAGGGTTCAAGGCAACTGCTGGTATTGAGCCTGAG
GATGTGGCGAAGCGCTTGATGGACTACGGATTCCATGGACCAACCATGTCATGGCCCGTTCCAGGCACACTTATGATTGAACCCACTGAAAGTGAAAGCA
AGGCTGAACTAGACAGGTTCTGTGATGCCCTTATCTCCATCAGAGAGGAAATTGCAGAGGTAGAAAATGGCAAAGCAGATGCGCACAACAATGTCCTGAA
GGGCGCTCCTCACCCACCCCAACTCCTGATGGGCGATGCATGGACTAAGCCATACTCTAGGGAGTATGCTGCGTTCCCCGCGGCGTGGCTTCGGGGTGCC
AAGTTCTGGCCAACAACATGTCGTGTGGACAACGTGTACGGGGATCGCAACCTGATCTGCACTCTGCAGCAGGCGTCCCAGGTGGCAGAGGAAGCTGCAG
CTGCCACCGCGTAATCTTCTGATGATGACGATCCTGGTGTGTGAAACAGTGTCAAGAAGTTATCATGCTTCCTGTAGGAGGGAAGCATGCTTGCTTCTAA
ATCCCTCATGTACTGTATATATTCTCCTCAAATGCCACCTTCTCATGTATCCTCTGTACCCCCCCACTGCCTCCCCATTCCCATTTGAAAGTGAAATTAG
CTATATTGGCTAGCATTTCCACTCTTCTCTGAATACAGGACAAATAATGGAGATCTGTTTTGATGTCCTAGCCATACACGGAAAGAAAATCTAGTTATTC
TCAAAAAAAA
page-top