Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25243  (registered. 2003)
Contig Information
Length 780 bp
Clones 88 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 12
Wh_EM Dormant seed with water absorption 7
Wh_EMC Dormant seed with cold treatment after water absorption 25
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 12
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 7
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 6
Homology (BLAST) Top Hit hypothetical protein OsI_26284 [Oryza sativa Indica Group]
Score 520
Evalue 4.76592e-51
Total Hit Count 305
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25243
TACGAAGGATACCACGCTTAACAAAGCATATATTATTCAACCTTGATGGGAGAGGGTAACAAGCCATCTAAAGATGGTGCTCCTTACAAAGTTTCAACAC
AACGGTAACAAGCATACACGCAGAGAGGTGGGCTATGCTAGATTTTCTGTATACTCAGAGCGCGCAAGCTGGTAACGCCTGCTAGCGCTAGCACACAACT
AAATATACTGCACCACCAATATATAGCTGCTTTGCATGTAGACTCTGATATGGAGCTGGCAGTTGCTCAGAAACCATGAATCTTGATGTGTTCCTTCTTC
ACAATGCCGGCCTGGACAAGGAAGTTTGAGACGTTCTTCCTCTGATCACCCTGGAGTTGAATGACCTGTCCAAGTTCTGTGTCCTGGACAACTGTACCAT
TGCAGCAAAACTCTTTCTTGAGGTCTTTGAGGATCTTGCTGTAGCTGAACTCCTTCTTCAGACCCTGGACAGTGGTCAGGCTCTTGCGACCATTACGCTG
CTGGATGCGTACATGAACGTAGTCTTTTGATCCGGCAGCTGCACCAGCGTCCCCAGCATTCGCCTCGGCAAAGGGGTCAAAGGCAGTTGGGATCTGAACG
TCAAGATCAGACATGAAATCTCCTGCTGAGACTGGCAAAAGCTGCACCAAGAACCTGGGAGGCGGTCGAGGAGGAAGAGATCAACCAAGATCTTTCCCGG
GAGGATTTGGATCGCGGAGAGGCGCTGGTAGTGAGTCCTTGGTGTTCTTCCTCCTCTTTGGGTTTGATCCCTCGTGCCGA
page-top