Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25241  (registered. 2003)
Contig Information
Length 1556 bp
Clones 88 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 13
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 13
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 6
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 7
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|48475219|gb|AAT44288.1| putative B2 protein [Oryza sativa (japonica cultivar-group)] >gi|51038049|gb|AAT93853.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579502|dbj|BAF17865.1| Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|218197041|gb|EEC79468.1| hypothetical protein OsI_20486 [Oryza sativa Indica Group]
Score 653
Evalue 8.3176e-148
Total Hit Count 123
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25241
GGCAGCAGTACAGAAACAGCAGCATCAAGTCAAATGCAAGGTTCCAACTTTCCAAACCAAGGTAAGGTACAGAGACAACAAGATACACTCCCAACATCAA
CCACCCTCACTTTGGGGCGTTCCTGATGCATCACAACAGTATCCCCCGTCTTTCGGGGTTTCCCCGCTGGCGGCGGGCATACTGCACTACAAATACATAA
ATATGAAGAAGAACATACACATCACCGAGATTACGGACAGACGGCACCGACACAGACAGGCTCACATCTTTAGAGGCCTACTTCTTCCGAGTACCAGGTC
CTTTCTGGGGGAAATGCAACCACCAACCAACAGCTTGCGCTTTCATGGACGACGGACGGGACAGATCATTGTGAAAACATCTTCCACAACTTACAGGGAT
GATATTTACTAAAAAGAACCACAGAGCAACCACAAACATGTTCCGAAGCAGATCAGGCGTCTTCTGTCTTGCACAGGTCTAGCAGTGACAGTGTCTCTGC
TATGGAGAGCTCGAGGCGGAATTTAGGACCATCATAGTGGTGCAGCACTGGCCTGAAAGCATCCTCTTCCAAGGCCTTGCAAAGCCTTCTAATGCGGATC
CTCACCTGTGCTGGGAATCTGGATTCACCTTTGCACTTCTTATCTTCCCAAGCAGTGGGATCAATGTTTGATCCTCCAAAACTAGCAGCCTCAAACACCC
CATGTAGCTGATGGGTCGTGTAGTTGTAGAGGAAAAAGAGGTAGACCAGGAGTGATGGCTCGGACTGAATCACGATATCTTGCTGGCAAGCCAAAAAGCT
GTCTCTTGAGATCCTCCTGCATGGTATCATTGTTGCAGACAAAGATGTATCCACCAAGAACTTCATTCCTCGGTAGCATCTCGCTTGTTGGCAATGTTTT
GAAGCGCTTGTCAACAGAGTTGTTGTTGCTGTTGCCCTCCATTGTTGTTGTTACCACCATTGTGTTTGCCGTTTGCTTCCTTCCCATTCTGATTATTCGG
ATATTTGTTGACCCCGACATTCATCTTGAATGAATTGACATTACCATTGTTTCCCTTGGGGTACATCGGATTCATGTTATAGGCCATGTTGCGGAAAGGG
TACTTCATGGCAGCCTCGTTCATCTTGAGATCATTCATCTTAAGATCCAGGTTCATGAGGCCAAGATTGAGGTGGTCCATCTTGTTGTCTTCTTGGTGGT
AGGATAGCTTATCCCATTGCTTCACATCAGGGACGGTGTTCATCCGTGCATACTCAAAGTCATTCATCCTCTCAGCCTTTGACTTTGTGATCTCAGCCAG
CTTTGATGTCATGAGAGACCATTGGCGGTCCTCCACCACCTTTGATTGCCCACGGAACTCATCTCCGAGATGCCACAAGTTGTCCATAGCTCGGTTCAAG
CTCTCTGCAAGATTCGGCGCCGGATTCCGGCGGGGAGGGCGCTGGATTTGGGGGCGAATCGCGAACTGCTGCGAGGAGGAGAGGAGTCGGCTCGGCTGGC
TTGGCGTTGGCTCCCACTTCGCTCCGCCCACACGGAGTCCACCGGTCAGAGAGGCG
page-top