Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25230  (registered. 2003)
Contig Information
Length 598 bp
Clones 85 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 3
Wh_KMP Shoot grown under continuous light 13
Wh_KMV Shoot grown with continuous light after cold treatment 15
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 11
Wh_V4816 Shoot grown under cold condition for 16days 13
Wh_V483 Shoot grown under cold condition for 3days 12
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit RecName: Full=Metallothionein-like protein 1; Short=MT-1 >gi|170787|gb|AAA50846.1| metallothionein-like protein >gi|51243716|gb|AAT99562.1| metallothionein [Triticum aestivum] >gi|51243718|gb|AAT99563.1| metallothionein [Triticum turgidum subsp. durum] >gi|51243720|gb|AAT99564.1| metallothionein [Triticum turgidum subsp. durum] >gi|51243722|gb|AAT99565.1| metallothionein [Triticum aestivum] >gi|51243724|gb|AAT99566.1| metallothionein [Triticum turgidum subsp. durum]
Score 172
Evalue 6.11809e-11
Total Hit Count 40
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25230
TTTTTTTTTTCAGGTAACTGAAGTAGCGATTTAGGACTAGTTAATTAGGTAAATCTTTCATTCTTACATATTCATCACTCCATCCATAGTGGAGATAGAT
GAAGCAATTACAGGGCAGACATGCGCACACACATACACACAAGGACACCATGGGCAGAGCATAGGCGGAGAGCGAGCAAGCAAATCACACGCACACGCAC
CCTTGCTCGACTCCATCAGATCAGACGCTCGTTATTCAAGTATACTCTCACACCATCACACGTACGTACGTACGAGTGCATGCAGCTTAACAGTTGCAGG
GGTTGCACTTGCAGTTGTCGCCGCAGCTGCAGCCCTCGCCGGACTGCCCGGCGGCCACCTCGAACTGCCCCGCCTTGTTCTCAGGAGCCACGCCGAGCAC
GACCACGGCGGCGACCTGGGCGGCGGCGCTGCCCTGCTCTGTCAGATCAGGGTACATCTTCCCGCACTTGCAGTCTGAGCCGCAGCTGCAACCGGATCCA
CAGTTGCAAGACATCCTCCAAATCTGTGAACCCAAAAAGATTTCAAGGAGAAGAAGATGGGCTTTGGTATCGGGGATGATGATGAGTCTCTCTCTCTC
page-top