Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25228  (registered. 2003)
Contig Information
Length 1447 bp
Clones 83 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 9
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 19
Wh_RDr Root of dessiccated seed 3
Wh_SHDr Shoot grown with dessication 14
Wh_VABA Shoot with ABA treatment 15
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 5
Homology (BLAST) Top Hit hypothetical protein OsI_13431 [Oryza sativa Indica Group] >gi|125587845|gb|EAZ28509.1| hypothetical protein OsJ_011992 [Oryza sativa (japonica cultivar-group)]
Score 942
Evalue 1.4458e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25228
TTTTTGGCTTTTTTGGCAGATTTTCAGATGTGCTTCTTGCTACAAACTTTTCGCCGACTGCCAGAAAAAGAACTACAACTTTCACTTACCTTGCATGACA
TTTTTTTTAGAAAAGGAGGAAGACCTGCATCTGGTCGATGCAACCTTGCATGACATATCAAAGCTAATGTAGCGACACATTTAACCGAATGACAGTCGAC
AACAAGGGGTAAAAAACATTAGCACGGTGAAACTCAAGTATCCTTTCCGGGTCACTCCCAAGCTTTATTCTGCGTCTATCACCATCAGCTGAGATGGATG
GTCTATACGCTCCAGAAACAAGCACGCGGCGGCGCGCGGCCACGGAAATATGCACTAAATAAGCAGGAAAACATCACACACGCAAATTCAAGTTCAACAG
CCATTGTCCGCGAAGAAACACGGCCTATTTCGTCATCATCACCCTGGTCGTTATTGTAGAGTTCACTCAAAGGGACGCCCTGCAAAACGGCTGGGTCCTA
GTACCCACCCTGGATGTAGGCGTTGAGCCGGTTCAGCTCCTCCTTGTGCTCGCTGACCACCGCGCGAACCACGTCGCCGATGGAGACCATCCCCATCATC
TCCGTGCCGCTGATCACCGGGATGTGCCTGATACGCTTTTCTGTCATCAGCTGCATTGCTTTCAGGACTCTGGTTTCAGGTTTCACCGTGATCAGCTTGT
TCTCTTCGGTCATGATATCTCCAACTTTGGTTGACTTGGAGGATCGACCCTGCACTATAATTTTCCGGAGATAATCTCTCTCTGTGACGATGCCCGCAAT
TGATTTATCTTCCCCAGGTTTAACAACCACCAAAGCTCCCACATTGTGCTGTGTCATCGATTTGACAGCATCATAGACACTATCATCAGTGGTGCACCAG
AGCCATGATCCATCGGCACTCTTCCCTTTAGACTTCAAAATGTCTGCAACAGTGCTGCTCTCAAATCCACTCTCCTCTATTTGAGCAGATGATACTGACA
TGAAGCGTGGGAACACAGCGGGCAGCATAGCAGGCTTCACAACACTGATGTGTTGCAGGACAGCAGATTTGAGCACACTGCCATGTGATCCGATAGCTTG
AATTGCTCGCTGCATTTTGTTTTTCCGGTGACGGCTTTCCGCCTGCTTTCAGCGTCTCTTTCCTCCGCTAAATCTAAAGTGAACAGTGGCCGGCTAGCAG
AATGAGATGAAAAACAACAGATCGTGGAGAAACCTAGAGGAACAACACCGGGAGCACACTCATCTGACCCTTCTGCTCGCTTCAAGATGACAGCACGCAC
TGTAGACGCATTTCTTTTAGAACTAACACTCCACAGATCGGTCATGAACTAGGCAGCTAGTACTATGGATCGACCCATCGCATGGATTTGGTTGGACCGG
AGGAAGGGGGAGGAGCAGCGAGTTGCGGGGAGGAAGAAGATGGGGGA
page-top