Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25227  (registered. 2003)
Contig Information
Length 1165 bp
Clones 83 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 18
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 15
Wh_V483 Shoot grown under cold condition for 3days 12
Wh_VABA Shoot with ABA treatment 10
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 5
Homology (BLAST) Top Hit RecName: Full=Cytochrome b6-f complex iron-sulfur subunit, chloroplastic; AltName: Full=Rieske iron-sulfur protein; Short=RISP; Short=ISP; AltName: Full=Plastohydroquinone:plastocyanin oxidoreductase iron-sulfur protein; Flags: Precursor >gi|32394644|gb|AAM88439.1| putative Rieske Fe-S precursor protein [Triticum aestivum]
Score 1071
Evalue 1.17443e-114
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25227
CCGCGCCTCATCTGCAAGCCTGTGGTGGACACAGGCAGTGCTAGCTCGCTCGATCGATCGTCCTCTCAACCACCATGGCCTCCACCGCGCTCTCCACCGC
CTCCAACCCCACCCAGCTCTGCCGGACCCGCGCGAGCGCGCTGTGCAAGCCCGTCAAGGGCCTGGGCTTCGGCCGGGAGCGCGTCCCGAGGAACATCACC
TGCATGGCCGGCAGCATCTCCGCGGACCGCGTGCCGGACATGAGCAAGAGGGAGCTGATGAACCTGCTCCTGCTGGGCGCCATCTCGCTCCCCACCTTCG
GCATGCTCGTCCCCTACGGCTCCTTCCTCGTCCCGGCCGGCTCCGGGAGCAACGCCGGAGGCGTCGCCGCCAAGGACAAGCTCGGCAACGACATCCTCGT
CGAGGACTGGCTCAAGACGCACGGCCCCAACGACCGCACGCTCGCCCAGGGGCTCAAGGGTGATCCTACCTACCTTGTGGTTGAGTCCGACAAGACCCTC
GCCACCTACGGGATCAACGCCGTGTGCACGCATCTTGGATGCGTCGTGCCGTGGAACGCCGCCGAGAACAAGTTCCTCTGCCCCTGCCATGGATCCCAGT
ACAACAACCAGGGCAAGGTCGTCCGTGGGCCTGCACCTCTGTCGCTGGCCCTGGTTCACGCGGACGTTGACGACGGCAAGGTCGTCTTCGTGCCGTGGGT
GGAGACCGACTTCAGGACCGGCGACAACCCGTGGTGGAAATAAGCGACGCAAGCTCCGGCAGCAATGCTCACTTGTGTGATATGTTAAGCCTCCTGCCAG
TCCTAAGAACGCTGCTATAAGACTACTCCTGCTATAAATGCACCTGTTTCTTGTATCCAGTTATATGTATACAGTCTATGGAAGGAGAAACCTTTTTCAT
TGCATATATAGTAGTATCACATTTTGAGGGCTCTGAATCTGGTAGTACCTACGATGTAGACGACTCTTTTTCTATAGCAGATCAAACCTGAACCTGAATC
TACACCTAGATAGCAATCTGAATAGTTAAAGAGGTAGCATGGCATATCTGCAGCATTGTTCAAAAGGGCAATGCAGAGTCGATATGTTCTGGGAATGATA
CAAGCCACTGTCTCTAGAGGCTATTCTCTCAAGTATATTTGGCATAGCTTCTCTGTTCAGAAACG
page-top