Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25226  (registered. 2003)
Contig Information
Length 2991 bp
Clones 83 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 7
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 13
Wh_KMV Shoot grown with continuous light after cold treatment 7
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 5
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 9
Wh_VSCB Liquid cultured tissue 6
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os08g0564100 [Oryza sativa (japonica cultivar-group)] >gi|28071305|dbj|BAC55994.1| putative iron inhibited ABC transporter 2 [Oryza sativa Japonica Group] >gi|42408451|dbj|BAD09633.1| putative iron inhibited ABC transporter 2 [Oryza sativa Japonica Group] >gi|113624497|dbj|BAF24442.1| Os08g0564100 [Oryza sativa (japonica cultivar-group)] >gi|125604356|gb|EAZ43681.1| hypothetical protein OsJ_027164 [Oryza sativa (japonica cultivar-group)] >gi|215693235|dbj|BAG88617.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218201615|gb|EEC84042.1| hypothetical protein OsI_30302 [Oryza sativa Indica Group]
Score 2088
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25226
TTTTTTTTTTGTTAAAAGATATGAAAATAAACACGGATCGTCTGGTAAAATAGTGTAGAGAAGATATGTTTTAAGCGATACAATAGTACTCATACTTGTC
ACGCTAAATGATGGAAACTTTTCTGATACAGGCAAAACTTTGGGGTTGTCTAGATCTCCAAAGAGCCGAGAGAATGAAAAGACAGAAAATCTAGAGACCA
GCCCTTTTCTTCAAGTGTTGCTTGAAATCCATGATATCGCCTTCCCACCTAGTCACCGCCTGGTTCTCACAGACCCAGATCTCTTGAGCAACCTGATTGA
TCAGCCTGAAGTCATGGCTCACCAGGACCAACCCCCCGTCCCATTCCTTCAGTGCCTCAGCAAGTGAGTCAATGGTCTCAATGTCAAGATGATTTGTCGG
CTCATCAAGCAACAGCATCTGTGGCTGCCTAAATGCTAGCCAAGCAAAAATGACACGGGCCTTCTGCCCATCAGACAGGTTTTTCATTGGCATCACCTGT
GCCTTTCCTGACAGGCCAAACTTGCCAATTGCAGCTCTCATCTTCTCCTCTTCATTCCCAGGGTACTCCCTCATCATGTACTGCAGGGCCGGCATGTCCA
GGTCCAGCTTCTCAGTGAGATGTTGATGGAATTGTGCAATGCGTAGGTGGTTGTGGCGTCTGACCATGCCATCCAACGGAGATAGGTCACCTGTCATGAG
CTTCAGAAGTGTGCTCTTACCAGCCCCATTGGGACCGACCAGTGCAACTCTCGAGTCAAGGTCAACACCGAAGTCAAGGTTCTTGTAGATGAGATTATCC
GGAGTGTAACCAAATGTGACATCAGCAAACTGCAGCACTGGTGGTGGGAGTTTGCCAACATCTGTAAAGCGGAATACAAGAATCCTGTCATTGACAACCT
TCTCAGCAAGACCACCACGCTCCATCTTTGCAAGAGTCTTCTCTTTGCTCTGAGCCTGACGAGCAAGCTTCGCAGATCCATGACCAAATCGTGCAATGTA
CTCCTTCATATTAGCTATCTGTTCCTGTTCCCATTTGTACTGCTTCATTTGATTCTCTTCAAGCTCAGAGCGAGTTTGAACATACTGGTCATAATTTCCA
GTATATAACTTGAGGGTCTTGTTCTGCATGTGGATGATGTTAGTGCACACTCCATTTAGAAAATCTTGGGAATGCGAGATAACAACAAGTATACGCTCAA
AATTCTTTAATTTCTCTTCCAGCCAGACACAAGCCTCGAGATCAAGATGGTTGGTTGGCTCATCAAGCAAAAGGATGGTCGGGTTCATGAACAGCGCCCT
TGCCAATGCAATCCTCATACGCCAACCCCCAGAAAAATCTCGTGTTGGCTTTGCTTGCATTTGCTTGTCAAAACCTAGACCAAACAATATCTCAGCAGCA
CGCTTTTCAGCAGTTGATGCATCCATTGCTTCTAACCGCTCATATACAAGATCCAAAGCTTCACCGCCACCATCATCCTGTGCAGCCAAAATTTCAGCTT
CCTTTTCCAATTTGGTCAAAGTCAAACTTTATAAACTTTGACAAAGTTAACATATACAATAAGAAATCAACACCATTAGATTCATTATCAAATATACTTT
CACATAGTATAAATTTGTTATGGTAAATATTTATATTTTCTTCTATAAACTTGGTCAGACTTTAGGAAGTTTGACTTCAGTCAACTCTAATATGCGAAGT
AAATAAAAACAGAGGGAGTACAGAAGATATATATGTGCATCCTCGCAGTCGCAGACAACTGGAAAAGGAAAATTATCTTTCTGTGCTGCCTCTTTTTCCC
TATCTGATGATGGTGATCTCTGTGATACAACGTATGGCTTGACAGTGAAAGGCACCTATGCATTGCAAACCACGACAATGGTGAAGAAAAAAAAGATGTT
ACACAGCGTAACAACAAGCTCATACTCCGGTTCTTCATGCTGCTACGGCTACAGGTCTTTTGCTGGTCTTGATTCCTTTGATAGCTTCAGCATAGTCTTT
AGCTCCGAAAACCGCAGAACCAGCAACAAGGGCATTCGCGCCAGCTTCAATGACCTTGTAGGCATTTTTGGGGCTGACTCCACCATCAACCTCAATCCAG
GGGTTCACTCCCTTCTCTTCACATAATTTTCTCAAATCAGCAATTTTCTTTACTTGGCTCTCAATGAAGCTTTGCCCACCAAACCCAGGGTTGACTGACA
TAATCAATACCAGATCAACAGATTCAAGTACATATTCTATCGCACTGAGTGGGGTCCCAGGGTTCAAAACAACTCCAGCCTTTGCTCCTAGACTTTTAAT
CTGATCGACTGTTCGGTGCAGATGGATGGTTGCCGTTTGCTCACAGTGGACGCTAACAATATCAGCACCTGCCTTGATAAAATCAGGAATTCGCTGCTCA
GGTTCCACAATCATCAGATGCACATCCAATGGAAGATCAGTCACTGGACGCAGAGCATCAACAATCAATGGTCCAATCGTGATGTTTGGCACAAAGCGAC
CGTCCATGACATCAACATGAATCCAGTCACATCCTGCCACCTCCACAGCTTTTACCTGTTCACCAAGCTTGGCGAAGTTTGCAGAGAGAATGGAAGGGGA
CACAATGATGTCACTCTTGGAGAAACTGTCGACCCTTGATGCCTTCACTTGGAATAGCTTCCTGGACGAGGAGAAGCCGGCGCGGCGGCGGGCGCCGAGG
GAGGCGGCGCGCGGGTAGCCGAGGCTGGAGCAGAGCGACGAGGACGGGGACGCCATCTGTACCGCCGTGTTCGTCTTGTGTGTCTGTGTCCACCAACCAA
AACTCGCTCGCGCTGCCGCTCTGCCTCTGGCGGAATGGAATGGAAACGCTGCCGATTTGGTGGGGGCTAGGCGCGGGGAGGGGGGAATCGCCGGGCGCAG
CCGCAGCCTCACGACGGCTCCGTCTCGTTATCTGCTCGCTGACCCCGTAGCCACACAGAGATTGCAGCGTCTCCACGCCTTTCGGGGGCAC
page-top