Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25223  (registered. 2003)
Contig Information
Length 1132 bp
Clones 82 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 16
Wh_EMC Dormant seed with cold treatment after water absorption 17
Wh_EMI Dormant seed with water absorption after breaking 22
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 7
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit cation transport protein chaC [Zea mays] >gi|195630483|gb|ACG36635.1| cation transport protein chaC [Zea mays]
Score 994
Evalue 9.52679e-106
Total Hit Count 441
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25223
TTTTTTTTTTGAAGCAAAGCATCACAACTCAGCGGCGCAGAAGTGCTGAAGTCGCCAAATGCATTTATTATTAGGGTATCACAAGGGAAGCAATAACACT
TGAAGTCTTAGGCTTTCGCATTAGCACTCTGGAAGCTACAGCCTTTGCCACAATAGTTGCCAAAGAAAATTAGCGCACACCCTCAATGGTGCCAGAGCTG
AAGTAAACCACAGATCTTTCAATGGTAGAATGTCAAGAGTGAGTGTGGTCAGAGGAAAATGCCATCTCTTTCGCTGATCCAGCCGTGCTGCTCTTCTTAC
TATGTTGAAACCGCAACGGTGCCCTCAGGAAGAGCAGAGATGTGCACAACAGGTGTATGCGATTTTAATGGTATGTCGGAGCCGGTAACCTTCTTCTCCG
TCGACCTGCTCAGCACCTTCCTCACCTCATCCGCAAGCACAATGATCGAGTCGTCTTCATGGCTTATATTGGACAGTGCCTTCTCCATTGAGAACAGGTA
GTCCCTATTATATCCATTAGGGCCACTGGCTGTAGCAATTTGCCTTGCCATATCCTCCAAAGCAGCAGGGCCAAGATAGTATTTGTTGCCAACTGGATCA
GGAGTGGATACGAAAACTAATACATCCGTCACAGCTGGTTCCAGAGAATTTCCATCCTTGTAGAAATCCACAGAGATCTTCTGGTCATACTCGCATTCTC
TTCTCTCCAAGTACTGCATTGCTTCTCGCTCTTTTTCTAGACCACCTTTGACACAATAAGCAATTCCCCAGCATATGGCTTCATCTTCGGATTCAAGGGT
GCAGGTCCTGGCCGGATGCTGTGGTGTGCCTCTATGGTCAATGCAAGCAAGATTAAACGTTCGCTTGTATCCCTTGATGAATCCCAGGATCTTCTCGTCG
AAGTCGAATCCGGGGTTCCAGATCAGGGACCCATACCCGAAGACCCACAGCACCATCCTGCTGCTGCTTTTCCCCCTGGCCGGAGGAGGGACGCCGGAGA
GAATGCCGCGGGTGGGGTCGGCGGCGCGGGGGGGGGAGCAAGATGGGGATTTGACTCTCCTCTTGCCTCGCCCGCGTCTCCTCTCCTCCGCCGGCGGTCT
TCTTCCCCGGGACGGACGGACGGATGGGGGTT
page-top