Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25217  (registered. 2003)
Contig Information
Length 2177 bp
Clones 80 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 38
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 13
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 15
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 1
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os11g0703900 [Oryza sativa (japonica cultivar-group)] >gi|62733235|gb|AAX95352.1| dnaK-type molecular chaperone hsp70 - rice (fragment) [Oryza sativa (japonica cultivar-group)] >gi|77552703|gb|ABA95500.1| Heat shock cognate 70 kDa protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113645762|dbj|BAF28903.1| Os11g0703900 [Oryza sativa (japonica cultivar-group)]
Score 1741
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25217
CGCTCCTCCCACCACCAAAACCCTAGCGCCGCCACCGCCAGCACAACCGCTGTACTTGCAAACCGAGCGACAGCTGCAATGGCCGGCAAGGGCGAGGGTC
CCGCCATCGGGATCGATCTCGGCACGACCTACTCCTGCGTCGGCGTGTGGCAGCACGACCGAGTTGAAATCATCGCCAACGACCAGGGCAACCGCACCAC
CCCCTCCTACGTCGCCTTCACCGACTCCGAGAGGCTCATCGGCGATGCGGCCAAGAACCAGGTCGCCATGAACCCGGTCAACACCGTTTTCGATGCAAAG
CGTCTTATTGGCAGGAGAGTTAGCGATCCTTCTGTCCAGAGTGACATGAAGCTGTGGCCCTTCAAGGTCATTGCTGGACCTGGAGACAAGCCTATGATTG
TTGTTCAGTACAAGGGTGAGGAGAAGGAGTTTGCTGCTGAAGAAATCTCCTCCATGGTCCTCATCAAGATGCGTGAGATAGCTGAAGCGTATCTTGGCAG
CACCATCAAGAATGCTGTGGTCACTGTCCCCGCCTACTTCAATGACTCCCAGAGGCAGGCCACCAAGGATGCTGGAGTGATTGCAGGCCTAAATGTTATG
CGCATCATCAACGAGCCAACCGCTGCTGCTATTGCTTATGGTCTTGACAAGAAGGCCACCAGATGTTGGTGAGAAGAATGTTCTCATCTTTGACCTTGGT
GGTGGCACCTTTGATGTCTCTCTTCTCACCATTGAAGAGGGCATCTTTGAGGTCAAGTCCACTGCTGGTGACACTCACCCTTGGTGGTGAGGACTTTGAC
AACAGGATGGTCAACCACTTTGTCCAAGAATTCAAGAGGAAGAACAAGAAGGATATCAGCGGCAATCCCAGGGCTCTCCGTAGGCTGAGGACAGCTTGTG
AGCGGGCGAAGAGGACCCTCTCCTCCACTGCGCAGACCACCATTGAGATCGACTCGTTGTATGAGGGCATCGACTTCTACACGACCATCACCCGTGCCAG
GTTTGAGGAGTTGAACATGGACCTCTTCAGGAAGTGCATGGAGCCTGTTGAGAAGTGCCTGAGGGATGCTAAGATGGACAAGAGCACTGTCCATGATGTT
GTCCTTGTTGGTGGCTCCACCAGGATCCCAAGGGTGCAGCAGCTGCTTCAGGACTTCTTCAATGGCAAGGAGCTGTGCAAGAACATCAACCCGGATGAGG
CTGTTGCCTATGGTGCTGCAGTCCAGGCAGCCATCTTGAGTGGAGAGGGCAACGAGAAGGTCCAGGACCTCCTGCTGCTTGATGTCACGCCTCTTTCTCT
TGGTCTGGAGACTGCTGGAGGTGTCATGACCGTTTTGATTCCAAGGAACACCACCATCCCCACCAAGAAGGAGCAGGTCTTCTCCACCTACTCTGACAAC
CAGCCTGGTGTCCTTATCCAGGTTTATGAGGGTGAGAGGACCAGGACCCGCGACAACAACCTGCTGGGCAAGTTTGAGCTCTCCGGCATCCCTCCTGCCC
CCAGGGGTGTGCCCCAGATCACGGTGTGCTTCGACATTGATGCTAATGGCATTCTGAACGTCTCTGCGGAAGACAAGACCACTGGGCAGAAGAACAAGAT
CACAATCACGAATGACAAGGGCAGGCTGAGCAAGGATGAGATCGAGAAGATGGTGCAGGAGGCAGAGAAGTACAAGTCAGAGGACGAGGAGCACAAGAAG
AAGGTGGAGTCAAAGAATGCCCTGGAGAACTATGCCTACAACATGCGCAACACCATCAAGGACGACAAGATCGCCTCCAAGCTAGCTGCGGACGACAAGA
AGAAGATCGAGGACGCCATTGACCAGGCCATCCAGTGGCTGGACGGCAACCAGCTTGCTGAGGCAGATGAGTTTGACGACAAGATGAAGGAGCTGGAGGG
CCTCTGCAACCCCATAATCGCCAAGATGTACCAGGGTGCCGGAGCTAACATGGCGGGTGGCATGGACGAGGACGATGCACCTCCGGCTGCTGGCGGCGCT
GGCCCCAAGATCGAGGAGGTCGACTAAGCGAGCACTTGTACCAGTCTTACCCTAAAGTTATTCCGTTCGTTATGTTGGATGCTACTGCAGTACGTGGTGT
TGGATGTGATGTGTGTGAACCTGCGTTTGCTGCTGCTTTTCTGTTAATGTTAGTTGCATCTGGTGATAAAAAAAAAA
page-top