Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25199  (registered. 2003)
Contig Information
Length 1070 bp
Clones 78 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 20
Wh_EMC Dormant seed with cold treatment after water absorption 9
Wh_EMI Dormant seed with water absorption after breaking 22
Wh_KMP Shoot grown under continuous light 2
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 12
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit cation transport protein chaC [Zea mays] >gi|195630483|gb|ACG36635.1| cation transport protein chaC [Zea mays]
Score 991
Evalue 1.96305e-105
Total Hit Count 444
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25199
TTTTTTTTTTGCTTAAGTCGCCAAATGCATTTATTATTAGGGTATCACAAGGGAAGCAATAACACTTTCAAGTCTCAGGCTTTCGCATTAGCACTCTGGA
AGCTACAGCCTTTGCCAAAGAAAATTAGCGCACACCCTCAATGGTGCCAGAGCTGAAGTAAACCGCAGATCTTTCAATGGGAGAATGTCAAGGGTGAGTG
TGGTCAGAGGAAAATGCCATCTCTTTCGCCGATCCAGCCGTGCCGCTCTTCTTGCTATGTTGAGACCACGACGGTGCCCTCAGGAAGAGCAGGGATGTGC
AGAACGGGAGTATGCGATTTTAATGGCATGTCGGAGCCGGTAACCTTCTTCTCCGTCGACCTGCTCAGCACCTTCCTCACCTCATCCGCAAGCTCAATGA
TCGTGTCGTCTTCATGGCTTATATTGGACAGTGCCTTCTCCATTGAGAATAGGTAGTCCCTATTATATCCATTAGGGCCACTGGCTGTAGCAATTTGCCT
TGCCATATCCTCCAAAGCAGCAGGGCCAAGATAATATTTGTTGCCAACTGGATCAGGAGTGGATACGAAAACTAATACATCCGTCACAGCTGGTTCCAGA
GAATTTCCATCCTTGTAGAAATCCACAGAGATCTTCTGGTCATACTCGCATTCTCTTCTCTCCAAGTACTGCATTGCTTCTCGTTCTTTTTCTAGACCAC
CTTTGACACAATAAGCAATTCCCCAGCATATGGCTCCATCTTCGGATTCAAGGGTGCAGGTCCTGGCCGGATGCTGTGGTGTGCCTCTATGGTCAATGCA
AGCGAGATTGAACGTTCGCTTGTAGCCCTTGATGAATCCCAGGATCTTGTCGTCGAAGTCGAATCCGGGGTTCCAGATCAGGGACCCATACCCGAATACC
CACAGCACCATCCTGCTGGCCGGAGGAGGGGCGCCGGAGAGAATGCCGCGGGTGGGTCGGCGGCGCGGGAGGAGGAGCAAGATGGGGATTTGACGCTCCT
CTTGCCTCGCCCGCGTCTCCTCTCCTCCGCCGGCGGTCTTCTCCCCCGGACGGAACGGGATGGGGGTTCG
page-top