Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25196  (registered. 2003)
Contig Information
Length 1318 bp
Clones 77 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 25
Wh_DPA20 Seed DPA20 9
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_MS Seed DPA5 of DT3DL CS wheat 9
Wh_OKCS Seed DPA5 18
Wh_PCDAM Anther at meiosis 8
Homology (BLAST) Top Hit alpha tubulin-2A [Triticum aestivum] >gi|90289598|gb|ABD92931.1| alpha tubulin-2D [Triticum aestivum] >gi|90289600|gb|ABD92932.1| alpha tubulin-2B [Triticum aestivum]
Score 1422
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25196
TTATGGTGTAGATAACCAGATAGCATGCATATTAACCAAGGTGCATAACAGGTTCAAACATACAAGGTTCTTACAACACAACAGGTTGTAAAACAAACAC
CACAAAGCAAATGTTCAAACAGACAGATAACAGATAAAGCCACTCGGGCAGATCATAGGATTGCAGCAGCATGCCTTGGGAAAGCACCAGGAGGCAGGCT
CTAGTACTCGTCGCCCTCGTCACCGTCCTCACCCTCGTCAAACTCAGCACCAACTTCTTCATAGTCCTTCTCCAGGGCAGCAAGATCCTCACGGGCCTCA
GAGAACTCTCCCTCCTCCATGCCCTCACCCACGTACCAGTGGACGAAGGCGCGCTTGGCGTACATCAGGTCAAACTTGTGGTCGATGCGGGAGAAGACCT
CGACGACACTGGTGGAGTTGGAGATCATGCACACAGCCCTCTGGACCTTGGCAAGGTCACCGCCTGGGACAACACCAGGTGGCTGGTAGTTGATACCACA
CTTGAAGCCAGTGGGGCACCAGTCAACAAACTGGATAGTGCGCTTGGTCTTGATGGTGGCCACAGCAGCGTTGACATCCTTGGGCACAACATCACCACGG
TACATGAGGCAGCAGGCCATGTACTTGCCGTGGCGGGGGTCACACTTGGCCATCATGGAGGAAGGCTCAAAGGCGCTGTTGGTGATCTCAGCAACAGACA
GCTGCTCATGGTAGGCCTTCTCGGCTGAGATCACTGGGGCATAGGAGGAAAGCATGAAGTGGATCCTCGGGTAGGGCACCAGGTTGGTCTGGAACTCGTT
GACATCAACATTCAGAGCACCATCAAACCTCAGGGAAGCAGTCAATGATGAAATGACCTGAGAAACAAGCCTGTTGAGGTTGGTGTATGTTGGGCGCTCA
ATGTCAAGGGAGCGGCGGCAGATGTCATAGATGGCCTCATTGTCAAGAAGGATAGAGACATCGGTGTGCTCAAGGAGTGAGTGGGTGGACAGGACACTGT
TGTATGGCTCAACAACAGAAGTGGAGACCTGGGGAGATGGGTAAACTGTGAACCCAAGCTTGGACTTCTTTCCATAGTCAACAGAGAGACGCTCCAGGAG
AAGCGAATCCAAGGCCAGAGCCAGTTCCACCTCCAACAGCGTTGAAGACAAGGAATCCCTGCAGACCAGTGCAGTTGTCTGAAAGCTTCCTGATACGATC
AAGGCAGAGATCAACAATCTCCTTGCCAATGGTGTAATGACCACGGGCGAAGTTGTTGGCTGCATCCTCCTTGCCACTGATAAGCTGCTCAGGGTGGAAG
AGCTGGCGGTAAGCGCCC
page-top